For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 132 bp
Wild Type = 133 bp
>chr2:125773330-125773462 133bp AGCCCAGCCCAAGTCCTA GGATGATAGAAGCCCATAACTTG
Sequence
TGGGAAACAATAAATGGATGTGGAGTGTGGCAAGCTCTCAGGCTGGATTCTCTTACGATGCTGTGCTCATGGATATTACAAGTGCAGGttatcagcaaaaaaagctgatggtgtcagtggtgcctctccctaggagtattgtgaaggcactgctctctgtcttattgtttgttctgctttgatattactcttggatgtcaatagatttttttctctctcttgtttggttttgcagacaatttcctttatataacaacgatatacgatggcagcagcccagcccaagtcctaccggaccctaccttgcctaccccattatatctgctcagccacctgtttccacagagtacacctattaccagctgatgccagcaccctgtgcccaagttatgggcttctatcatccttttcctaccccttactccagcaccttccaggctgcaaacactgtcaatgccataagcacagaatgcaccgagcgtccaaatcagctggggcaggccttcccgctgtccagtcatcggagcaggaatggtaacagagggccagtggtgccaaaagtgagtggccacactgtgtgtgtagtttttaaatatgctatttctgttgttagtactagtataggtaatttactacttggaccattggccTTTAATGCTTAATTTGTCACAAAGTATTCATCACTAATAAAAAGTGTTGTAGGTATATTATTTAAAAATTTTTTTTCTTGTGATTTATTACCCCTCTTGTTTGAAAGTGTAATTTCAAGTCATCCTCATGATCATTCAGAGAGTTTTACATAAACATAATTTACAATTATTTCTAAATTATTTTGATTTAGTGCTAAAA
This mutation is a 562 bp deletion beginning at Chromosome 2 position 125,773,086 bp and ending after 125,773,647 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44462 | AGC CCA GCC CAA GTC CTA | Wild type Forward | A | |||
| 44463 | GGA TGA TAG AAG CCC ATA ACT TG | Wild type Reverse | A | |||
| 44464 | Fluorophore-1 | CTC AGC CAC CTG TTT CCA CAG | Quencher-1 | WT Probe | ||
| 44465 | ACA AGA GGG GTA ATA AAT CAC AAG | Mutant Reverse | A | |||
| 44466 | CGA TGC TGT GCT CAT GGA | Mutant Forward | A | |||
| 44467 | Fluorophore-2 | AGT GCA GGT TTA ATG CTT AAT TTG TCA C | Quencher-2 |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44462 | 0.40 uM |
| 44463 | 0.40 uM |
| 44465 | 0.40 uM |
| 44466 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.