For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 117 bp
Wild Type = 116 bp
>chr2:30472246-30472361 116bp GACGTTCCGCTCTCCTGAGT GAGGAAATGTGACCGAAACG
Sequence
CGCGCACCTGCCGCAGGTGAGGCCCAACCATGCGGAAGGGGGCGGAGCCATCTCCGCTGCGCTCAGGTGAGCCGACCCCCAGCTCGCAGGAGCCACGTCCAGGAAAGCTACGAATTTCGACGTGGCTCCCAAGAGGCGACCCAAAGCTGAGAGAGACTACCTCGGAGGCTCCTAGTCCcacgaggtgccgcggccccaggagaacattcgaggcaacggcggcgttggaggcccggggtccgttcgttatttgaatagcacaaaggaaccgccttggtctgattggccagtcaagtggtcccggggagggcagtggctgtcagtcggaaggctctacacgcttctattggctaatctacagtggggcggggcgctgctgcccagctaaatagttggggccggggccggcggaggctcattgctttggcgccgtctggggagcgtgagcctgcgggtggcgcgcaacgcatggtggcgacttctctcggagtgtcgccgacccgccgacccgggctcggttccctgtgcctggctcgcccgggcgaccaactggagacacacgcaaggagcagcattcgcagcaccagaggcggctgctccgccgcccgcgtctccgcgggagcatggagtgcgccctggacgcccagagcctgatcagcatctccctgcgcaagatccacagctcccggacccagcgcggcggcatcaagctgcacaagaacctcctggtgtcctacgtgctccgcaacgcgcgccagctctacctgagcgagcgttacgccgagctctaccggcgccagcagcagcagcagcaacagcagccgccccaccaccagcaccagcacctcgcttacgcggcgcccggaatgccggccagcgcggccgacttcggcccgctccaacttggcggcggcggggacgcggaggcgcgcgagccggttgcccggcaccagctgcaccagctccaccagcttcaccagctgcacctccagcagcagctgcaccaacaccaacacccggcgcccaggggctgcacggcggcggcgccggtggcggtggccggggcgcccgcgggctgcgcgggggcgctctcggagctgcccgggtgcgctgcgctccagccgccgcacggcgcgccccaccgcgggcagcacttggagccgctgcagccgggtcccgcgccgctgccgccgcccgcgcccgccgcgctctgcccgcgggaccctcgcgtcccggccgcttgctctgcgccctcggtgcttccgggggctgccccttcgaccgtcgctgcctcctctccgcccgcctctacagccccttcctcatccactggcttctaccggggcgcgtacccggccccctcggacttcggcgtgcactgcagcagccagaccaccgtgctggacctggacactcacgtggtgaccacggtagaaaacggctacttgcaccaggactgctgcgcctccgcccactgcccctgctgtggccagggcgctccgggacccggtctggcgtccgccgctggttgcaagcgcaagtattaccctggccaggaggaagaggacgacgaagaggacgcgggcgacctgggagccgagccccccgggggtaccccattcgccccctgtaagcgcgcccgcttcgaggacttctgcccggactcgtccccggacgcgtccaacatctcaaacttgatctccatctttggctcgggcttctcggggctggtgagccgacagccggactcctcggagcagccgccgccgctcaacgggcagctgtgcgccaagcaggcgctcgccagcctcggcgcctggactcgagccattgtcgccttctagggacccccgagggcatggggaccctgggccccgcggggctggggccagacaaagactcggccaaggggcgatagggagcgagcgggtcctggccactcggggctgagctggggacgagcagaggctgatgttttataaattgtaaaataaaaaaaaaaaatctaaaaatcttggactttatttttgcagagaaaaagcgcctatttaagtatgctttgtgtttctcttactcttttccccccctttttattgtactgattgcagtggtgtttagcgaggagcctgccacgtgaggcagggctgctgcccggaggaggtgcccggccgccgggggcgaggctgggtgcccgggcgcgccaggggcgcaacgcaggagggcgcggggccccggacgccgattctaatcagttgtcaagagccgggaagcccgacgttccgctctcctgagtgcctttctggggtgaggaacgggtcttgtgaaaccctgagcaaaaaaacaaaggcaaactctatctccaaaagggacgtttcggtcacatttcctctctgggggcggcctccaaagttctcaaaatgagaaggcagaaatgaaaacacttcaacttttttttcttttcttgccgggttgggcgtctagaacccctcctctccccgcccctctggctccgtcctcctccccctcctccacccgcctcgcggactcgggcgggggggggggggggcaccctgacactctcagcacagttgggaaaggggtggagggcgagcagggcgaactacatttcccatcatgcccagcactgcggtcctcactaaacaaaaaaggaagtcgattccttcacctggatccccgggggagggaggggcccggaccgccgactgagctggagacttttcgcttagctcctggtcagctctagtgattgtgcgcgcttctaagttaccttgtgctttagccttcggtcccatctcatgaaaccagcattgttccagcctgtgagaaccctgtctccgtcctcagcgcgatagattttgtttaatttaaaagccttttgttgtgagaaggtgaggttcgcttagtgcccctctgggtctctgccatcaacaccccgaggactccaaaacaagttgccaaccttgccttcccggcccttcttcctcctgtatttttgtgcataatgaattgtatctcaccgggtaaaactgttcaggttatttgtttaaatttataatcttaataaaaagtcaattgtagagtgtatggtggttcctttgctttcacatgggcttagaggtgagaaaatctaaacacacacacacacacacacacacacgcaagcaaacaccagctttccagggccatggtggaaacccatggatacccccatatcCGCAGGGCCAGGGTTGGAATTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCTGGGGATGGAGCTAGGGTTGGGAGTCAGTATGTGTGCGTTCTGGGGATGGAGGCCGGTGCTACAAGGTCTTCTCCATAAGCCCTCCTCACCAGCGGGTCTTGCCCCCTTGGGAACCCGCTGCCCAGCAGGAAGCTGAGCCAGCCTCCAACATATTTCCATG
Mutation details
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44453 | GAC GTT CCG CTC TCC TGA GT | Wild type Forward | A | |||
| 44454 | GAG GAA ATG TGA CCG AAA CG | Wild type Reverse | A | |||
| 44455 | Fluorophore-1 | CCT TTC TGG GGT GAG GAA CG | Quencher-1 | WT Probe | ||
| 44456 | CAC ACA CAC ACA ATT CCA ACC | Mutant Reverse | A | |||
| 44457 | CAC GTC CAG GAA AGC TAC GA | Mutant Forward | A | |||
| 44458 | Fluorophore-2 | AGA GAG ACT ACC TCG GAG GCT CC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44453 | 0.40 uM |
| 44454 | 0.40 uM |
| 44456 | 0.40 uM |
| 44457 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.