For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:24813087-24813168 82bp CCGGCATGGTTTTACTTTG TTCGTGTCCAATTTCAACTGTC
Mut= 82 bp
Wt= 82 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CAAGTTAACAACGACCAACCAACACAGAACCCAGGATGAAGGAAAAGAGAACCTACAGACTCCACACACCAGTGCAGAAAGCTAATACTAATACAGCAGAGAATCTTGTTTGGTGACACACATCCACATCTTCACCTGACCTCTTTATTGTCTATAACAGACAGGCACGAGCAATCCCATAGCACAGTGATGTAGTTctgggataaccttgacaaaaatacaggtaagataggctatccaagatgacttcagactgaagaaaactctggccaacctttgtctttagaattttatagatttggttgaatcattgtagttttcctataactgtccgaccacccaggggaatcatacagtttgaaaatgtctcctatgcaatcgagcccgtggaaaccctgtcaggatttgtgcacgtgatctatgagaacacaaacaaacatgctgtgattcctgacctgggaaagaatcagtcatacagttggtttgacgaatcagattatcaattccggagtaacatgaaggtcagtgctcactctttctacttatttagtataattttgtgaaatgaaaaaaaaatttttttaaatactccttaccatggttttactttttaaacatccttttttttttttttttttttctcctctgtatagccctggctgtcctagaactcactcacagagcctgcctctgtctcccaagtgctgatgttaaaggctagtgctaccaggcctggcccggcatggttttactttgtaaaggaaggtcctgtgtcatcttCTAGTAGCTCGTGGATTGACAGTTGAAATTGGACACGAATTCTGTAAACACGTAGATGATAAATCCCAGAAGCAAGGTGCTTTGAACATAGAACTGAAAGTGAGGCAACAACTTTAGACAATTAAAATTCCAGGTCACTTCAGTAAAGTATTAACTCTTTCCTTGCCATTC
This mutation is a 583 bp deletion beginning at Chromosome 8 position 24,813,126 bp and ending after 24,813,708 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44436 | CCG GCA TGG TTT TAC TTT G | Wild type Forward | A | |||
| 44437 | TTC GTG TCC AAT TTC AAC TGT C | Common | A | |||
| 44438 | ATA ACA GAC AGG CAC GAG CA | Mutant Forward | A | |||
| 44439 | Fluorophore-1 | AAA GGA AGG TCC TGT GTC ATC TT | Quencher-1 | WT Probe | ||
| 44440 | Fluorophore-2 | CCC ATA GCA CAG TGA TGT AGT TCT AG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44436 | 0.40 uM |
| 44437 | 0.40 uM |
| 44438 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.