For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr14:13954816-13954947 132bp TGCCAATTGTGAGGGTAGAG TTTTACGTGCATCTTGACACA
Mutant= 118 bp
Wild Type = 132 bp
Sequence
TTTTTTTCTTTTTTTGCTTCAAAAGTAGTTCTCTTAACAATTATTGACTTAGCCTTTCTGATATACCTGAAAATTTCCTCTCAACAACCCATAGAATGCCAATTGTGAGGGTAGAGTTTTACCTAAGACCTCAGCCCCTAggacaggcagatataccttggacaatcacttttctttgaagagaaaaatagaagaaagatttttaattgtgtcaagatgcacgtaaaatttatcatttttgtgttcacctcaactgatggcattaaatgtatttatttttcagtaattttcttttcattgagcaaatgagtagttatatactgttgtcttgagagttgctcagaaccaaatattcgttttaattctcattcatcttttttcctccagacgaagttatacggaaacgtcttctgattgatggagatggtgctggggatgatcggagaattaatctcctcgtgaaaagcttcattaaatggtgcaactctggatcccaagaggaagggtactttattccactgacgcttctgtatcagtatcctggtggaactttattaaggccatgttaaatagttcaatttaccttatctgtccagtgcggccacctctagactgatcagaagtttggtttatttatttgtttgtttttgttttttttttttttgttttttctgttcttctatttggaggtctcctttatgtttgtataATATGCAGATAGGACATTAGTAAAAGAAGAAATGAAGGCTTAATAATTTGATTACTTTTAGCAAAGGAAGGTTTTTTCTTTGTTAAGTTAAATTTAAGTTGCTGCAAAATAATTATATACTAATAATTACATACTGTATTAGTTAGGGTTTTACTGCTGTGCACAGACACCATGACCAAGGCAAGTCTTAT
A 569 bp deletion beginning at Chromosome 14 position 13,954,335 bp and ending after 13,954,903 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44371 | TGC CAA TTG TGA GGG TAG AG | Common | A | |||
| 44372 | TTT TAC GTG CAT CTT GAC ACA | Wild type Reverse | A | |||
| 44373 | AAA CCT TCC TTT GCT AAA AGT AAT CA | Mutant Reverse | A | |||
| 44374 | Fluorophore-1 | ACA GGC AGA TAT ACC TTG GAC AAT | Quencher-1 | WT Probe | ||
| 44375 | Fluorophore-2 | AGC CCC TAA TAT GCA GAT AGG AC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44371 | 0.40 uM |
| 44372 | 0.40 uM |
| 44373 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.