For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:120790560-120790661 102bp GCTTCAAATGTCTTCTGTGAGG TCTTTTCTCAGCTGTTTTCACTGG
Mut= 109 bp
Wt= 102 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AGATCCACCTACCTCTGCCTCCCTGCTGGGATTAAAGGTATACATGGCCACTGCCTGGCTCAATACTTGATTTTCTAAATTGGAACTTTTTGATAGTCTGTGATGTAATCTAGGAAAATTTTGCTTCAAATGTCTTCTGTGAGGATGTAATAAAGCCTATCAGCACagcacagaccttaacactgaatgaaacaattaaaccagtgaaaacagctgagaaaagataagtaactagcctggtgagaaagtatgactttattatttctaatgtgctttgtgtctgtgtgttttcagttgtgaaaatgtccacagaaggagggtttggcggtaccagcagcagtgatgcccagcaaagcctccagtccttctggcccagagtcatggaagaaatccgaaacttaacagtggtaaggaaaaacaaggagcttctaaagcagatcagtagaaacaagactcggGCACTTTTATTTTCAAGCATATTCAGGCGTAGTGTATTCCTGACCTGAATGTTGGGAAATAAAAATAGAATTTAACTTGTAGGAGGCAGTACCAAGGTGTGTTTGTGACAGTGGCCATCTGTTTAGATGTTCTGCTTGGAGGCAGGCTCATGTGGAACTGTGCTTTAGCCTATAGA
This mutation is a 292 bp deletion beginning at Chromosome 4 position 120,790,326 bp and ending after 120,790,617 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44147 | GCT TCA AAT GTC TTC TGT GAG G | Common | A | |||
| 44148 | TCT TTT CTC AGC TGT TTT CAC TGG | Wild type Reverse | A | |||
| 44149 | TTT CCC AAC ATT CAG GTC AG | Mutant Reverse | A | |||
| 44150 | Fluorophore-1 | AGC ACA GAC CTT AAC ACT GAA TGA | Quencher-1 | WT Probe | ||
| 44151 | Fluorophore-2 | CAG CAC TAT CAG TGC ACT TTT ATT TT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44147 | 0.40 uM |
| 44148 | 0.40 uM |
| 44149 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.