For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr16:17777180+17777279 100bp TTGTGGGTTATGTGGGCTGT TACCCCAGAAAAGCTGTACCA
Mut= 101 bp
Wt= 100 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CAGGTTTTAAACTAAGCCTACAGAAAGTTTCAGTTTTCTGTCAGAAGAGGTTGGGGTCGGTTGAGGAAAGATTCCACTTTGCTTCTCCCAGTCCCAGAAGGCCAGCTACAGGGACAGCCAGCTCTGTATGCCTTACTTCTGCTGTCATCCTGTCTTTAATATTCAGATGCAGTCCTCCAGCTAAGACttgagtgggtatccttctttttacagataccagaaattatccacttctgctgtgatttcctcatgtcatgggtagatgaggagaatatccttgatgtctaccggctagcagacctctttgacttgaaccatctgacccaacagctagatacctacatcctcaaaaactttgtggccttctccagaactgacaagtaccgccagcttcccttggagaaggtctactctctcctcagcagcaatcgcctggaggtttcctgtgagactgaagtgtatgaaggggccctgctctaccattactccctagagcaggtgcaggctgaccagatctcactgaatgagccccccaagctcctagagactgtgcgctttcccctgatggaagctgaggtccttcagcggctgcatgacaagcttggtcctagcccactgagggacacagtggccagtgcccttatgtaccaccggaatgagatcctgcagcccagccttcagggcccacagacagagcttcgctcggacttccagtgtgttgtgggctttgggggtattcactccacaccgtctacaatcctcagtgaccaggccaagtacctgaatcctctactgggagagtggaaacacttcactgcctctctggcgccccgaatgtccaatcagggcattgcagtgctcaacaacttcgtgtacttaattggaggggacaataatgtccaaggatttcgagctgagtcccgatgctggaggtacgaaagggcacttaccatcattgcctttattgttagacaactccatggtgcaggaattgtgggttatgtgggctgttcagggtacacgttatcaagggcacatctctacagacCTGCATCTGCCTTTTATATGAATGGTACAGCTTTTCTGGGGTATACCTGTGTCATGTAGTGAAGTCCAGATGAATCCAGACAAAGTGGACCACAGTGAAATAAGGAAAAGGGCATCAGAATTGCTTTCTTGCCTTTTGACCCTGCTATCCAGAAA
This mutation is an 861 bp deletion beginning at Chromosome 16 position 17,776,376 bp and ending after 17,777,236 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44136 | TTG TGG GTT ATG TGG GCT GT | Wild type Forward | A | |||
| 44137 | TAC CCC AGA AAA GCT GTA CCA | Common | A | |||
| 44138 | GCC TTA CTT CTG CTG TCA TCC | Mutant Forward | A | |||
| 44139 | Fluorophore-1 | CGT TAT CAA GGG CAC ATC TCT AC | Quencher-1 | WT Probe | ||
| 44140 | Fluorophore-2 | AGT CCT CCA GCT AAG ACC TGC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44136 | 0.40 uM |
| 44137 | 0.40 uM |
| 44138 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.