For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:21936978+21937081 104bp TGTTCTTTGGTTGGAGGTTTG CCCACATTCATGGAGGACA
Mut= 108 bp
Wt= 104 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CAAATACTCCTCTTGCCCATAGGCTGCACATAAGAAAGCAGGTTGGTTTGTAATGACTTCCCTGGGCCACCGGGTTCTAGTCATCTAAGAGTCCGTAAGACCCTCCCGCATGTCCACTATGCTTCTGGTCTCTAAACCCCGGATGAGGTAAGACCTATCACACACACTTTTGCTTGTTCATAGAGGGCaacaatcccacagggtcctcttgagaaccgaggcaacggaaaactaacaggtgggctatattctctgtttctgttttggttttgacaggaaacagcaagagctcgactccaaagatgctattattttgcatcagtttgcaagacctaacaatggtgtccccagcttgtctcctttctgtttgaaaatggaaacttacttaagaatggctgacctaccctatcaggtacttgtttgcaaatatgttttattcttgcgacatcgatatcacctagaggatggggtagttaatgtcacacaagtggatatcagagaaggcagggtctgaaggtaaccatacccagtcgtcagcaagagagacatgtgactccaggatctattgacttttgtttttccatcagttctaatgagggactcataatatttcttttaatgtgttctttggttggaggtttggctaggcttatggaacagctggtgagactgcctggtGGTACTTTTAGGTTTACATCTGTTATTTTGTCCTCCATGAATGTGGGGTTAGAAGGCATAATGGATTGGAAGTTCTAGGGCCTGAAGCTAGTGCCTCATGGCTCTCCCACCCAGCTATAGCTCTGGCCTTTGAAGAGATTTTAACTTCCCTATGTTCTGCTCAGGTGGTTTTTAAGGAAGTACCTG
This mutation is a 490 bp deletion beginning at Chromosome 4 position 21,936,545 bp and ending after 21,937,034 bp (GRCm38/mm10). In addition, there is a 7 bp insertion [TTTTAAG] at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44126 | TGT TCT TTG GTT GGA GGT TTG | Wild type Forward | A | |||
| 44127 | CCC ACA TTC ATG GAG GAC A | Common | A | |||
| 44128 | AAC CCC GGA TGA GGT AAG AC | Mutant Forward | A | |||
| 44129 | Fluorophore-1 | CTA GGC TTA TGG AAC AGC TGG T | Quencher-1 | WT Probe | ||
| 44141 | Fluorophore-2 | TGT TCA TAG AGG GCT TTT AAG GG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44126 | 0.40 uM |
| 44127 | 0.40 uM |
| 44128 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.