For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:141473421-141473546 126bp CTGGTGTCAGGTTTCAATCG GAGGCTGGATGTGGTCTCT
Mut= 114 bp
Wt= 126 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AGACTGGCACATGAGCAGGTGTAACTTCTAGGTGGGGAAAGGGTCACCTGGCTCCTCCCTGAGCATCTAGATACATATTTCAGAAATCTCCAGGCCATTTCCCTATGGCCTGGTGTCAGGTTTCAATCGCTGATTATGTAGATGTGCTCTGGTAACCCCTATCCACACGAATACCcagaggcaagctggaggtggttccaaacctatccagactctagagaccacatccagcctcactcttctctttacagggatgccctggacgctctgggcctaaagcgctactgctgccgccgcatgctgctagcacacgtggacctgattgagaagctgctgaactatgcacccctagagaagtgaccgctggagcctgccctcctctgtctcctgctggccacgggcagcctgtcgtgctatgttcaaactgagctattggggatgttggtgtattgcctggctgtggccctgtggctaagtcctgttaccctggaaggaactgtttagtaaagatgtttgcagaaccaccaacaggtctaacttccaaggtgctccatgtccatgtctgtgctgtctctgaggctacctggcctgcctccagtctttcccctagggctggtctccttccccttcatctgactgggagtctcgtcctgtggaggagtaccctgcttccgttccccggggccttgaccactttgatcaacgaggtagccctacagtagtcttgtaccacattgctttagggcctctccgcttcctgcctgtgttcaggatgggcataatggatgtgggcaccacaccatccacaggtatggatgggcccaagcctggtgacaatattcctttggaatgctgagcgtgcttggaggtcccaatccttgtgctagggttattatgcatttgggtatttggtctgcttataagtctttgtatcactgtgtccccacagaggccagatcccctgagagtaaagttatagaatgtataagctgccatcaggtattgggaatcaaacccagatttatttacctttcattttccaagacagggtttctctgtttggccttgactatcctggaattcaactctgcagaccaggctggccttgaactaaagagatcagtctctgcctcccgagtgttgagtttaaaggacggcttgtgccacccaaccaaacccagatactgtaggagtacgcccaaggccacaggcctcacgaatttcttgggtcctaaagcccatcagctgtgtgagcctatctgctgcccatgcctgaggatcttgtttccagaatcttcccaggcccgacagctaggcagccctgccccttgacccaatccccacagcatgtagtcctaagaagcctactctaggccaaaggaggtggtgtagtgctttagctcctaggcatctgcatcaagtaccccgggttctttctagcacattgatccctttgagaattttggtgggtttttttgttttgttttttgagaccagctttggctggtttgaaactcacaacagtcagcctgcctttacctcttggattctgggattaaaggtgtgtgtggcatagcatacccaccctaccccacccctggttttttgttgttttaaagaaaaaggcgggctggtgagatggctcagtgggtaagagcacccaactgctcttccaaaggtccagagttcaaatcccagcaaccacatggtggctcacaaccatccgcaacaagatcctcttctggagtgtctgaagacagcaacagtgtacttacatatattaataaataaatctttaaaaaaaaaaaaaaaagaaaaaggctttgccttaggctagagtccagagaacccatagtggcctcctccagctggcacagaagactgtggggaacaaaatcagcttaggacctcttctcagctgcttagatgagctaaagccagagaaacaggagccagggcatccccaacaggccctggtgcctcccttgccctctgaccctagcAAGGCCTACAGACTCTTCCTTGAGCATGGACAAGTCCAGGCCACAGTGGGCTGGGGGGATGTTCCAGCTACCAGTGCTCACCCTAACTGTAATTGCCATTGGGCTTCACCAACCTTGACTCTTGTGAGTACTCCAGCTACCCTGGACCATAAGGTCCTGTCA
This mutation is an 1828 bp deletion beginning at Chromosome 7 position 141,471,653 bp and ending after 141,473,480 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44098 | CTG GTG TCA GGT TTC AAT CG | Common | A | |||
| 44099 | GAG GCT GGA TGT GGT CTC T | Wild type Reverse | A | |||
| 44100 | CAC TGT GGC CTG GAC TTG T | Mutant Reverse | A | |||
| 44101 | Fluorophore-1 | AGG CAA GCT GGA GGT GGT | Quencher-1 | WT Probe | ||
| 44102 | Fluorophore-2 | ACG AAT ACC AAG GCC TAC AGA CT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44098 | 0.40 uM |
| 44099 | 0.40 uM |
| 44100 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.