For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:24792818-24792933 116bp AGGGCAAAATTGAGAACAGG GCCCTGTTTATGCCTTTCA
Mut= 111 bp
Wt= 116 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
AGCAAAATCAAAACCAAAATAAAAAACCCCAGGGAGCTACCAAGAGAAAAAGTCCCAGGATAGGGCAGAGGAACAAATTAGAGTAAAGGAAAACAAAGAAACAAAAAACAGAGAGGGCAAAATTGAGAACAGGAAGGTCAGACTCACAGGGCACTAGAAGTAGCCTCCCCAAAGCccaacgggtgagagagccccaggaagctgagccggtgaaaggcataaacagggcttcattactctcctttgtagtattcaagaaatgctgacgggccagaggctgtgccactcggaaactcacaatgacacggtcctggcggcgctgaatcagcaaagaagtgatggcattctctgcgacgtgaccctgatcgccgaggaacagaaattccacgctcacaaggcggtcctagcagcctgcagtgactacttccgggtaagtgaaggtggatgtgtttgtcttaggatgtcagtgcacagaggacagcctgatctttcctaggccgtgagccaactacatggcGGAAGGCAGATTTGTAAGTGTTGAGAACCTGTGTACCTTCctggacagaacTGAGTCCAGGACCCTGGTGGGACATTCACTGGACTGGGCTGGGTGGCTGCAATGAGAAGCAGACCGTTGCATCTGACTAATACATTTAACAAGCACTGAATGGTGTGGCAGTGACATGCATGGCATATGAAGATATGGTTCTTTTTTCCTAGAACTTGAAATTTGATTTCCAGCTGTGAGTG
This mutation is a 342 bp deletion beginning at Chromosome 4 position 24,792,530 bp and ending after 24,792,871 bp (GRCm38/mm10). There is an additional 11 bp [CTGGACAGAAC] del 40 bp after the del site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44093 | AGG GCA AAA TTG AGA ACA GG | Common | A | |||
| 44094 | GCC CTG TTT ATG CCT TTC A | Wild type Reverse | A | |||
| 44095 | CTG GAC TCA GAA GGT ACA CAG G | Mutant Reverse | A | |||
| 44096 | Fluorophore-1 | CGG GTG AGA GAG CCC C | Quencher-1 | WT Probe | ||
| 44097 | Fluorophore-2 | CAA AGC GGA AGG CAG ATT T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44093 | 0.40 uM |
| 44094 | 0.40 uM |
| 44095 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.