For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:180583500+180583597 98bp CTATGTACGACATGCAGGCACT TGTACCACAGCTGACAGGATCT
Mut= 95 bp
Wt= 98 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CAAGCCTGTCGGTGAGCGCCGCGCCGCGCACCGGCGTGGGGGTGGGGCGGGATAAACCGTCGGGCGGGCTGGCGGAGCCTGCGACCTCCCACGGGACGTGGCCTCCCACTCTGGGGTGCCCTACTAGTCTAAGAGCCTATGACTTTCCTGCCCGAGAAGCCCTCTCCCTGgggacactcctgacttccctgcccttgagacactcctaccccagggaacgcctccattcccccccacccccccacctctgcagccccctgtccttggacccgcctactatacacaccctagcccctggaacacccacctgccttgtggcacctctcttcccctttgacatgtgactcctgcaacacttgcacctgcgggtttgcccactcctgcccctccttcttcacccatgtcctacgcacagaggtgctgtcctaaccctcaacccactgtcctacctctcaggggtgaatcggcacttccacatgatttgtatccgagacaagttcagccagaatattgggcgccaggttccatccaaggtgatctgggaccatctgagcactatgtacgacatgcaggcactggtgagttggatcctggcctgcccatttacgggctgaccgtgGAGTCAAGTCCCAGATCCTGTCAGCTGTGGTACAGGACAGAACCCTCTTCTCACTTGGGGTTTGGTATGCAGAGCAGAGGTGATCTCAAAGGATGAGGCTCCTTCCTCAGAAAAGCTTAAGTCCTGTTGTGAAAAGCACAGACTAGCGATGATCTCTGACTACT
This mutation is a 449 bp deletion beginning at Chromosome 2 position 180,583,115 bp and ending after 180,583,563 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44005 | CTA TGT ACG ACA TGC AGG CAC T | Wild type Forward | A | |||
| 44006 | TGT ACC ACA GCT GAC AGG ATC T | Common | A | |||
| 44007 | TCT GGG GTG CCC TAC TAG TCT | Mutant Forward | A | |||
| 44008 | Fluorophore-1 | CCT GGC CTG CCC ATT TA | Quencher-1 | WT Probe | ||
| 44009 | Fluorophore-2 | AAG CCC TCT CCC TGG AGT C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44005 | 0.40 uM |
| 44006 | 0.40 uM |
| 44007 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.