For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr1:93811938+93812038 101bp CCTACGAGATGGTGAGTGCAG ACATTTCCATGCACCCTTACA
Mut= 86 bp
Wt= 101 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TGTAGATGAGTTCATAGCTGCCATTAGGCCAGCTTCTCTTTCCCACCTCTCAGCTGGAGAGACCCACCGTGGTACCTGGAAACCTTGTGGGAGTAGCCTCTCTCCCTGAAACCACAGAGAGTCCCACTTCTCAGTCAGAGCAAAGAGTTGCACATGTCTCTGCTGTTgctattcatggaagcatccaggatgtttctatgtgtcatgctgtattgttcactcctttggctatgtgacttaagttgtgcaacaggaaccaggcaaggtgaccatatgggtgtgctgctgtctagaaattgtacagtgacatggccagcgatgctcttgccagcttcctgaatgcttgtcactgcctcttacggaagtcacctgtcctcattagataagaaagcagagatcgacatcctggctgcagagtatatttccacagtgaagactctctcgtcagcccagcgtgtggagcacctccagaagatccagagcgcctacagcaagtgcaaggagtacagtgatgacaaggtgcagctggccatgcagacctacgagatggtgagtgcaggggccagtgcagcctcctgctgccttccgtgcccctgaagGAGAGTGTGCAAGCAAGTGTGTAAGGGTGCATGGAAATGTGTAAGGTGTGTAGAAATGTGTAAGGGTGTGTGAGAGTGTGTAAGGCTGTGTGAGAGTGTGTAAAGGTGCATGGAAATGTGTAAGGTGTGTAGAAATGTGTATCTGGAATAGGAGTTTG
This mutation is a 432 bp deletion beginning at Chromosome 1 position 93,811,567 bp and ending after 93,811,998 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 43741 | CCT ACG AGA TGG TGA GTG CAG | Wild type Forward | A | |||
| 43742 | ACA TTT CCA TGC ACC CTT ACA | Common | A | |||
| 43743 | TCC CAC TTC TCA GTC AGA GC | Mutant Forward | A | |||
| 43744 | Fluorophore-1 | CCT GCT GCC TTC CGT G | Quencher-1 | WT Probe | ||
| 43745 | Fluorophore-2 | ACA TGT CTC TGC TGT TGA GAG TGT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 43741 | 0.40 uM |
| 43742 | 0.40 uM |
| 43743 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.