For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr18:34769017+34769115 99bp CCTGGGAACTCTTCTGTCTAGAGT CTAAGGACTAACTTGACAGGGCAGA
Mut= 90 bp
Wt= 99 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GTAGACCAGGCTAGCCTCGAACTCAGAGATCCACCTGCCTCTGCCTCCCAGGTGCCAGGATTTAGAGGCATGGCATTACCACTTCACAGCTCATACAGGTTTCTTGATTGACTGCATTTTTGAggaggagtggcagacagtgtataaacattcttggtgccaggtgggttctcaggctgcaggtagcatggtgtgggtgggtttagatcctgttctgttcccttaatagctgtgcctgttaaccttggacaagcacagtcatagtacttccttcatggagacttttgagaaattacattctgtggtacagtagctcttagaatatgttagccattaacccttttcattatgcatgcctttcagaaggtgcttcctggaggggcctgccccactgttcctgtgctgagttccaggacagcctcaacttcagctaccatccctcaggcctaagcctgcacctcagaccacccagtcggggaaactcccccaaggagccgcccctctcccaagtactgagccccgaacccccagacccagagaagcttcctgtgccccctgcccctccatccaagaggcactgccgctcactctcggtgcctgtggacctgtctcgctggcagccggtgtggcggcctgccccctccaagctgtggactcccatcaagcaccggggcaatgctggagggggtgggccgcaggtgcctcagcagagccctccgaagcgggtctccagcctcaggttcctccaagctcccagtgcctcgtctcagtgtgccccagcccacagaccctacagccctcctttcttcagcctggccctggcccaagattccgctcagccctgcgccacctcccctcagagtggctcctgggagagtgatgcagagtccctgtcgccctgcccaccccagcgccgcttctccctgtcacccagcctgggcccacaggcgagccgcttcctgccctctgcccggagctctcccgcgtcttccccagagctgccctggagaccccgaggtctccgaaaccttccccgaagccgctcacagccttgtgatctggatgcccgcaaaactggtgtcaagcggcgtcatgaggaagactgcaggcgccttcggccttccttggactttgacaagatgaatcaggtgggactggcagaccagaagctgtttaaacatctcctaattccctaccttctggcaaggcctccctgggaactcttctgtctagagtttatacaagaaaaccaccctggcagtattgaattttaaCCTTTAATGTCTTCTGCCCTGTCAAGTTAGTCCTTAGTATTCTAAAGAAACTAGACTGAGGCCTTAAGCCTTCAGACAGGGATCCTAATTGTCCTGCCAGAGGCACTTTTCCTCTTCTCTGAGAACTCTAGACCACAGG
This mutation is a 1151 bp deletion beginning at Chromosome 18 position 34,767,928 bp and ending after 34,769,078 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 43728 | CCT GGG AAC TCT TCT GTC TAG AGT | Wild type Forward | A | |||
| 43729 | CTA AGG ACT AAC TTG ACA GGG CAG A | Common | A | |||
| 43730 | TGG CAT TAC CAC TTC ACA GC | Mutant Forward | A | |||
| 43731 | Fluorophore-1 | ACA AGA AAA CCA CCC TGG C | Quencher-1 | WT Probe | ||
| 43732 | Fluorophore-2 | CTT GAT TGA CTG CAT TTT TGA CC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 43728 | 0.40 uM |
| 43729 | 0.40 uM |
| 43730 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.