For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:152186249-152186338 90bp AGCGCTGGCTTTTATCCAGT TGTCATCCAGAAGAGAGCTATAA
Mut= 92 bp
Wt= 90 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
TTAAAACTATTAAATTTGTAATACTTAAGTATGTTAGAACAGGAGTTTTTGAGGTAAGGGAGTCTCAATTTCCTTTTATTTTTCATATTTATTGTGAAACAAAAGATTCAAGAAGAAATTATTAAAGCAAAGAATTTGGAGGAATGATTTAAAAGCTAAAACGTTAACataggatggatcttcagaaactattctgtttaattctaatgatgtttcaggccgtaagtgataagtcagagtttattagcagggcaatctgtaagtggtcagctgtctagactgccggcccttttcctaatcttgcttatgtcttcaccaggcttgaagggaggcgctggaggtactgatggacaaggaggtaccttcaggtacactttccacggagatcctcatgccacatttgcagcctttttcggaggttccaacccttttgaaatcttctttgggagacggatgggtggaggtcgagattctgaagaaatggaaatagatggagatccctttagtgcctttggattcagcatgaatggatatccaagagacaggaattctgtgggaccctcccgtctcaaacAAGACCctcccattattcatgaacttaaagtatcgcttgaagaaatatatagtggctgcaccaaacggatgaagatttctcgaaaaagattaaatcctgacggaaggagttacagatctgaggacaaaattctcaccattgagatcaaaaaagggtggaaagaaggcaccaaaatcacttttccgagggaaggcgatgaaacaccaaatagtatcccagcagacattgtttttgttattaaagacaaagaacatcccaagtttaaaagagacggatcaaatatagtttatactgctaaaattagtttacgggaggtaagtcagtaagtcagccctgagactctaagacggagagatgactgctgctgattgactagggggctgtctgggcagcgctggcttttatccagtgctctgcagacttattcctcatggtaaCTCTCTAGGAAGTGGTGCTATTATAGCTCTCTTCTGGATGACATCATAGTTTCTAAATTTATTTACTGATGTTAACTATTTAAATGTCGGTTTTCAAGTACAAGTTTGGTTAGCTACTTTATGGCCAGTGTTAGGTTAACTCTAGTTTTAGGTTGTGGTCTGTGAGATCCGCA
This mutation is n 837 bp deletion beginning at Chromosome 3 position 152,186,292 bp and ending after 152,187,134 bp (GRCm38/mm10). Also, after the deletion of 381 bp of sequence there is a 6 bp [GGTCTT] endogenous retention followed by an additional 405 deleted bp.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 43718 | AGC GCT GGC TTT TAT CCA GT | Wild type Forward | A | |||
| 43719 | TGT CAT CCA GAA GAG AGC TAT AA | Common | A | |||
| 43720 | AGC AAA GAA TTT GGA GGA ATG A | Mutant Forward | A | |||
| 43721 | Fluorophore-1 | CTG CAG ACT TAT TCC TCA TGG TAA | Quencher-1 | WT Probe | ||
| 43722 | Fluorophore-2 | AGC TAA AAC GTT AAC AAG ACC CTC T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 43718 | 0.40 uM |
| 43719 | 0.40 uM |
| 43720 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.