For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:32335340-32335455 116bp CCTTCCTTATGGGACTGGA TGCTAGACTGGAGGCCACAC
Mut= 114 bp
Wt= 116 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GGGCCAGTGCATGCCTGGTGCCTCCCGGCTGCCCTCCCTCTTCTCCCAGAACATCATACCCGAGTATGGCATGTTCCAGGGCATGCGTGGTGGGGGTGCCTTCTCTGGTGGCTCCCGATTTGGCTTTGGATTTGGCAatggcatgaagcagatgaggcgtacctggaagacctggaccacagccgacttccgggtgaataagctgacctacccctcctgatccatgctggaatatggctacaatctctgagttcactcctcctttcacttccagaccaaaaagaagaagagaaagcagggtggcagtcctgatgagccagacagcaaagctaccagaacagactgctcagacaacagtgactcagacaatggtaagttggggaatgtggtgtcctgctccctgtccccgtggggcccctggattgaacttgactgtcctctccttgcagatgaaggcactgagggggaagctgcagagggtactgaaagtgctgaggctatggagaaaggctcccgagcagtaagtaaccctagacctcaggctcttgctctctgcaggtggggcataggactccagagctggcttaaagacacacagccttgctacaagggtcacaggcaatgtggtcttacctgtatgcatggctagtgagtggccagcacaaggaggctgggtatctagggaaaagtacagaccacttcactaacagtgtgtttccttgggagaaatggggcgatgcaggcctctgtgcagcaggtagtgagtgggaaggtctgacgctcccttaatcctttagagcaggtataagtagctgtgccctttttaaaattgaattctaaaaattgtatattaggaaggagaagacgaggagggaaaagaggatgggagagaaggcaaagaagattcggagaaaggtaagtcttccatggttacctaggtactgggaaagctcttccaggtgcttgtagtgggaggaaaccagctgagggcagggttgtagcggaaagatggctggctgggaccttccttatgggactggatatatgttagcaaggcctcttcttactctgtgccctcccagcctgcctccgtttttcctaGGCAGAGGTTATGGATGGTGTGGCCTCCAGTCTAGCACTTTGGTTTTGCCTTCAGGTGGGGGCAGCAAGCAAAAGTGTGGGGAGCCCAGGCACCCCCCCCCTCAGTTCCTCAGTAATAGACAGTTCCAAGTCCTC
This mutation is a 964 bp deletion beginning at Chromosome 17 position 32,335,377 bp and ending after 32,336,340 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 43614 | CCT TCC TTA TGG GAC TGG A | Wild type Forward | A | |||
| 43615 | TGC TAG ACT GGA GGC CAC AC | Common | A | |||
| 43616 | CGA GTA TGG CAT GTT CCA G | Mutant Forward | A | |||
| 43617 | Fluorophore-1 | CTC TGT GCC CTC CCA GC | Quencher-1 | WT Probe | ||
| 43618 | Fluorophore-2 | CTT TGG ATT TGG CAG GCA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 43614 | 0.40 uM |
| 43615 | 0.40 uM |
| 43616 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.