For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr19:40836728+40836843 116bp GGAGGGAGAGTGTATTTGCAG CATATTGTGTAGTGAGAGCTTAAAGAC
Mut= 107 bp
Wt= 116 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GGAGCCTACTCACCAGTCCGCTCCCTTTCAACCAAAACTTTGACCTCCTTGGAGGGAGAGTGTATTTGCAGTGTGGTTTTTCTTAAAGCCATACACCTTCCACTCAActttattgctgcgctcctttcgagcaaagtgtgtctttaagctctcactacacaatatgttaggaaaacaacgttaagtcttgatactctgaagatacgtctatatattaaatattcctcctcttgatctaggagctgaagctgccttcttacaagggccaatctcctcagctgaacctcaggcggtattttgctgatttgattgccattgtgagcaatcgcttcaccctctgcccccctgcccgccatctcgccgtctacctgctggacctgttcatggaccgctatgacatctccattcagcagctacacttagttgcgctttcctgtctgcttctagcaagtgagtatgaactggagtgacccgactcaaggccgacagcgctgacaggatgaaaccggagaactcaccgcattattgtcaaatcccagtcacttcccatttattgcttttaggaaatttatattacaaatttattttatggttgttagttagatattaaaaaatagttcaggcatttttttttaaaacaacaaatgcctaaaccctacctcatcaaGATTGATACAAATACAGATTCTAGGCACCACATACAGTACAGGTTAATTGTCAACTAAACGTGATTTTGAATCTCCTAGGAGACACACTCTGCACATGGGAATTTCCAGAGAGGTTTAACTAAGGAGAAACCTACTTTGAGTGC
This mutation is a 560 bp deletion beginning at Chromosome 19 position 40,836,785 bp and ending after 40,837,344 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 43501 | GGA GGG AGA GTG TAT TTG CAG | Common | A | |||
| 43502 | CAT ATT GTG TAG TGA GAG CTT AAA GAC | Wild type Reverse | A | |||
| 43503 | CAA TTA ACC TGT ACT GTA TGT GGT G | Mutant Reverse | A | |||
| 43504 | Fluorophore-1 | CGC TCC TTT CGA GCA AAG T | Quencher-1 | WT Probe | ||
| 43505 | Fluorophore-2 | CCT TCC ACT CAA GAT TGA TAC AAA TAC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 43501 | 0.40 uM |
| 43502 | 0.40 uM |
| 43503 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.