For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:88125198+88125312 115bp ACTGGATGTAGTGATGTTAATTATGAG AGAGCTTCCCTTAAGCAAATGA
Mut= 112 bp
Wt= 115 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GCAGGAAGTTGCTGTTGTCCTTCAGTTCCCAGGGTTCAGAATGTTGAAGAGAGTCCCTTAAATGGCAAGTCTGACTCTTGATCCGCTTCCATCAAATGTTGTGGTCTTTGGCTGTGTCTCTTAAGCACTGCTGGAAGTGGTATCAAGActgaaggggtggagggtgtgtctgcttactaattttgtgtttatctctcatcagtgcttcttatagtggtgtctgtctgtacagctactggtgcctggaactggctaatagatcctgagacacaaaaggtagaaattttgttttaaagtctttagcagattaaataagatactggatgtagtgatgttaattatgagatatgccgagctacctttacctgctaCTAATAATGTTAATCCTTATATTAATAACATGCCCTGTAATCATTTGCTTAAGGGAAGCTCTAGTTGGCTGTTGTGAGTTACTTATCTTCATAAGAGAAAGATCTAAGAAAATTTACTCTGTTTGATATTTCTTAACTCATGTTTTTAATTTTTCTATTTCCAC
This mutation is a 223 bp deletion beginning at Chromosome 8 position 88,125,028 bp and ending after 88,125,250 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 43450 | ACT GGA TGT AGT GAT GTT AAT TAT GAG | Wild type Forward | A | |||
| 43451 | AGA GCT TCC CTT AAG CAA ATG A | Common | A | |||
| 43452 | TTG TGG TCT TTG GCT GTG TC | Mutant Forward | A | |||
| 43453 | Fluorophore-1 | ATG CCG AGC TAC CTT TAC CTG | Quencher-1 | WT Probe | ||
| 43454 | Fluorophore-2 | ACT GCT GGA AGT GGT ATC AAG ACT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 43450 | 0.40 uM |
| 43451 | 0.40 uM |
| 43452 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.