For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:64976962+64977076 115bp GAAGGCCAAGGTCACTTAAGAC GCTTTTTCACAGTATTATCCCTTTC
Mut= 106 bp
Wt= 115 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CCAGGACATTAGTAATCACTAATGCTTGTCTGTTAGGTTGCTCATTGCCTAATGCTGAAATGACTTAAGTAGTTTCTGCTGATGAGTCAGACATCCTTTCCTTTTGTGTTTTTTCTCCACTCTTACTGCCAgataaaagaaaggtaaagaaaagacttgaagtctagtaaaagaaggaaaaaactagcatttctatcttggaaggaaaaatactgttaatgtgtcatgctgaatgagtgtttgcattacatactcaataattctgttctttatctgggttttgtaattggttttaaattatttgttaccaaggaggcttagcaaaaatttgctaacttactctcttctcagttttcagctcatgaccttatcccgtctccaaaattaaagccctctcaaggaatgccagccagtgatgatttatgttttagcaaaaaaaggtcatcaagaaacttatttcagagtagtcgggactttaactcagagtcagttcctacatgtggtgctggtgagtaaatatttgaaataaatgctattgaagactagctaaaaagcagacactttgacataattgtgtcatgagatcataggtcatctcattgtaggctgttagtaatggaaggccaaggtcacttaagacactaatatttcttgagcataagtctacatgtcgGATATATTTCTTAATGTTCTTAATGTAGCTTTCAAGAAAGGGATAATACTGTGAAAAAGCTTGTATTCTATGTTGGAGGTGGTGGTATACACCTTTAATGCTTAGGAGGAAGGAACAAACAGATCTCTATGAGTTCCAGGCCAGGTTG
This mutation is a 542 bp deletion beginning at Chromosome 12 position 64,976,475 bp and ending after 64,977,016 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 43391 | GAA GGC CAA GGT CAC TTA AGA C | Wild type Forward | A | |||
| 43392 | GCT TTT TCA CAG TAT TAT CCC TTT C | Common | A | |||
| 43393 | GTC AGA CAT CCT TTC CTT TTG TG | Mutant Forward | A | |||
| 43394 | Fluorophore-1 | TTC TTG AGC ATA AGT CTA CAT GTC G | Quencher-1 | WT Probe | ||
| 43395 | Fluorophore-2 | CTC CAC TCT TAC TGC CAG ATA TAT TTC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 43391 | 0.40 uM |
| 43392 | 0.40 uM |
| 43393 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.