For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr1:36889478-36889588 111bp GCATTTCAGAGTTGCTAAAGTTCTG TGAGGTCAAGACTGGCATCC
Mut= 110 bp
Wt= 111 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CAGGCGTAGATAGGTATTTTCAAGGCACCTTGCACAGCTGGGTTATTGAAGCTGTCTTAGTATTGATCATGACTACATAGCAAAGCATTTCAGAGTTGCTAAAGTTCTGAAGCATTCGCTGTATTTTCCTCGtaaccattactctcatacaagcagtgtttccttggcttgttctggatgccagtcttgacctcagggccctcacaaatgctaattactctacctaccattggtctacattccccagtaagcaatatattaaaatgtaaaattgtatttactgcaaggcaaacggtgaaattgggtttctgttcctatcagtgatgtttggtttgttttcttgacagcattcattcagtcggagagcataatagaagtcctgcgctttgacgacggagggctactacaggtaattctcttgagtaatatgactattcttctttcctgccttggaaaccagtgtaactggttttcctgaagtatgttttatgaactgtagacagtcagtggagttattgcatgaacctcctactagaattactttttagagtaaacatttttctaaacagTGGACTCCCTGTGTAGTATGGAAGCTGTAGGTAAGTAAGTCAGAGTTTGTGTCCTGTGGCTGTGAGGGTATGTAAAAAAAAAAAAAGCCAGGTCAAATGAGGTTGGGTCTGTGAGCTCTCTGGTTGTTAGTGCTGAG
This mutation is a 437 bp deletion beginning at Chromosome 1 position 36,889,104 bp and ending after 36,889,540 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 43386 | GCA TTT CAG AGT TGC TAA AGT TCT G | Common | A | |||
| 43387 | TGA GGT CAA GAC TGG CAT CC | Wild type Reverse | A | |||
| 43388 | ACA GCC ACA GGA CAC AAA CTC | Mutant Reverse | A | |||
| 43389 | Fluorophore-1 | ACA AGC AGT GTT TCC TTG GC | Quencher-1 | WT Probe | ||
| 43390 | Fluorophore-2 | CCT CGT GGA CTC CCT GTG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 43386 | 0.40 uM |
| 43387 | 0.40 uM |
| 43388 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.