For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:79719381+79719489 109bp ACCACCCAAAACATTTGTCA GGCTGAGTTTGTTGTTTACTGA
Mut= 89 bp
Wt= 109 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CCGGCATAGGATGGATCATTCTTGTGATTAGTTTATAAAAAGGATAAAAACTTGGACTTGTGCAAATAGAGACCTTATATAACTCCAAAGATGCTTTGAAAAAACTAACCACCCAAAACATTTGTCATAGTATAAACTTTAGTGTGTGTAAGGGattgagcccaggacctcccatttttaaaataaacagtctatcagtaaacaacaaactcagcccattaggggatttttagagttgaaatctggatgaaagaatagaattctgcttaaatttcatattctaactgtcttctatgtcaacatttctagacaaatatgtatggtaattttatgttttaaatatgtaactttttcatggaaatttgtcattttcactgtttctagggtttggagtggatcaattacgggatgacaatctagaaacttactggcaatctgatggctctcagcctcacttagtgaacatccaattcaggtaatccatttcttacatttttttatatagtgtaggttgtaagtggacaaggaaatctattttattttcataaaagttaagaaaacatggaaagtaaaatgaaaatacttaattgctttcagactctattaggtcttagagatttttttttttttttgccatccagATTGCAGGTAGCTTCAATGTATTCGGCCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCAGTAAGTCAACAGGTTCTCCAGTGCAGGAGTGAGGATTAAAAAGACAGATAACATTGCAGCGTGACCCCAGGCAATTCTGAGACTGAAGGCCAATTTAATATTTCCAAT
This mutation is a 487 bp deletion beginning at Chromosome 8 position 79,719,428 bp and ending after 79,719,914 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 43358 | ACC ACC CAA AAC ATT TGT CA | Common | A | |||
| 43359 | GGC TGA GTT TGT TGT TTA CTG A | Wild type Reverse | A | |||
| 43360 | GAG AGA GAG AGA GAG GCC GAA TAC | Mutant Reverse | A | |||
| 43361 | Fluorophore-1 | ATT GAG CCC AGG ACC TCC | Quencher-1 | WT Probe | ||
| 43362 | Fluorophore-2 | TGT AAG GGA TTG CAG GTA GCT T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 43358 | 0.40 uM |
| 43359 | 0.40 uM |
| 43360 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.