For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:32470591+32470715 125bp CAGGAGCTCTATCCCTGAGC CTCTCTTCCCTCTAGAACACCA
Mut= 120 bp
Wt= 125 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TCTTTGGAATCCAGGTTCTCACACATATGAGGCAATATCTCACACATTCTACCCCACAGGCATGTCCCCAAACCCTCACTGGGGGATTCTGGTCAGGAGCTCTATCCCTGAGCCACGCCCCAGCCCCATTGTTCTTTCTTGTTTTAGAGtggggagcaactcagggaagctcagcaaggcaccatgtctttgcttttggtgttctagagggaagagagagtagtgagagggagaggagggggagggagggagggacagactaagccgagctgtcaggtcctcattgcccctttctatctgccacagtatcttcccaatgagaagggccttcaaaacgagaagaaggtgctggacaccatgcaccacatcatcctggcatgggttggacctttcttgcctctcctggtgcttgttcatcctgattacatcaagcctgtgttgggtgcctcaggtaggcaggttggaccgcagagggatgagtcaacttgaaactcccagaacccttctagggttacagacatgtgggtgccccacaggaagtgtgccttgagtaagtgtttgagggatggatagaagttcaccaaacTGGGGCCGGCAAAGCAGGTTGTGAGAACATGGACAATTGTGGGGTGGTGTGCAAGAGTTTCAGGAACATTGTAAGTCTCAGGCGCACCTGCTGGAGTCACATCTAAGCAACTGACTTATTCAAGGTTTTGGTAAGTAATTGTCGTTCAATTGTAGGCCATGACAGTCCAT
This mutation is a 437 bp deletion beginning at Chromosome 17 position 32,470,647 bp and ending after 32,471,083 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 43042 | CAG GAG CTC TAT CCC TGA GC | Common | A | |||
| 43043 | CTC TCT TCC CTC TAG AAC ACC A | Wild type Reverse | A | |||
| 43044 | CCT GAA ACT CTT GCA CAC CAC | Mutant Reverse | A | |||
| 43045 | Fluorophore-1 | AAC TCA GGG AAG CTC AGC AA | Quencher-1 | WT Probe | ||
| 43046 | Fluorophore-2 | TTA GAG TGG GGC CGG C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 43042 | 0.40 uM |
| 43043 | 0.40 uM |
| 43044 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.