For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chrX:73905847-73905946 100bp ATCTTGGGGGCGCTAAGT TGGTACATCTTCTTGGTCTGC
Mut= 93 bp
Wt= 100 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GGCCATGGCTCTTACTATGGAACAGGTTTGACCTGGCCTGAAGTCTCTCCAGCTTGGTGGAGTACCACAGCAGTCCTGCCCCTGAGCAGCTGCTTGTGTTTGTACAGAAACCACAGTCCAGAGTTCTCTGCCTTAGGGCCCTTCCCAAGtgcacaggggcttctgaacctgagtactttccttcggggcacacttctgttctttgctctagcttttagctcagtcaggtgccagggagcctttggtgtagacaggttgtctgtctctgcatctcctatgtctttctggtctggttggttcacggcttgcatgtctgcccgccctaaaccaaggtccccttgcagagatgcgctggcagttgagtgagcagcttcattgcctggagcttcagggagagcttcggcgggatttgctgcaggagctagctgagttcatgcggcgccgggcggaggtagaactggagtattctcggggcctggacaagttggctgaacgctttaccagccgcagtggtcgccttgggggcagcagccaggagcagcaaagcttccggtaggtaccacactagcagtagtgccttgcaggtcctgagacctaggctccttggtctgagttctcctctgctacaggaaggagccgactctcctgtcacccttgcactgctgggctgtgctgctggaacacactcggcagcagagtcgggaaagtgctgccctcagtgaggtgctggctgggcccctggcacagcgcctaagtcacatcagcgaagatgtgggacgtattgtcaaaaaggtagggtctgtggaagggctcagaatctaaccggaaaaaaaaaaaaaagcacatggggatctatctgtggttgagaggcatgggaggccaggtggaaattgtagtccaaggtcgtctcatcccaatctgaggtgggatgagttgtcacaggatgctgggaggcattaagtagagggatgctatggtcacacattccccttcatctctagagcaaggacctggtgcagcagttgcaggctgagctcctggaagtggtctcagaactccagacagtaagcaggacctgctgtctactaacaacaggaagcaggaacagctgctgcaagccattgcatctcccaatcaggctcaaaaaatggatgctcatgggagacctgagtctttagtctggggggcaacaggcatgggcccctctatgctctgagaacagagtagttaaataacaacacacttaggtgaaatggcccaaatttcagatctgaatcttgggggcgctaagtggggctgagggactcttcttagtcatgaccttcaGCAGGGCTACTTTGCCTGGGCCTCCCTGCAGACCAAGAAGATGTACCATGTGTACCACTCAGAGAGCATGAATGCTGAGACTAAACTTCGGGAAGCGGAGCGGCAAGAGGAGAAGCGGTCAGGCAGGAGTGCCTTATCCACC
This mutation is a 1177 bp deletion beginning at Chromosome X position 73,905,895 bp and ending after 73,907,071 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42979 | ATC TTG GGG GCG CTA AGT | Wild type Forward | A | |||
| 42980 | TGG TAC ATC TTC TTG GTC TGC | Common | A | |||
| 42981 | CAG AAA CCA CAG TCC AGA GTT C | Mutant Forward | A | |||
| 42982 | Fluorophore-1 | CTG AGG GAC TCT TCT TAG TCA TGA C | Quencher-1 | WT Probe | ||
| 42983 | Fluorophore-2 | CTT CCC AAG GCA GGG C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42979 | 0.40 uM |
| 42980 | 0.40 uM |
| 42981 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.