For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:43443887+43443976 90bp GCACCCTAACATCCTCAGGT CATCTCCCTCCTTTCCCAAG
Mut= 88 bp
Wt= 90 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case; and insertions with carrots ^g^ (C insertion):
GGCGGGACCGAGCCTTGGACGGGAGGCTAGAACTTAGAGGCCCCGCAGCCTGGGTTAGAGATCCTTGAGCTAGCAGCCACccaacCTGTCGGGCACACACGGAGCCTTGCCTCCCCCAGGTTCGGCACCGACAGTCGGGACAAGTCATGGTGCTGAAGATGAACAAGCTCCCCAGTAACCGGAGCAACACGCTAAGGGAGGTGCAGCTGATGAACCGGCTCCGGCACCCTAACATCCTCAGGTGAACGGCCTAGCCTCTT^gctggacagcttgctgggcaggaggaaaagtcccttgggaaaggagggagatgcagtggagcccgggctcttacagcgtatcctttatcctccccatcacctttcaggttcatgggggtctgtgtgcaccaagggcagctgcacgcgcttacagaggtaagcattaagcataggccaggaaagagggaaggcaccacacccccaagtgagagtgtcagtgatcttggtgggtctgctgggaaattaaaaagaagccacctgcctgcccaggacctcaggacctcctccaactaaaggcttcctgaacttccctgtgtgcaaaccacttattagaatactcagctggagttagtgatggagatattttgtatctgggtccaatacaggagccactagctacacgtggaatagactaaaacaagagctggtgtaacaaaagaatgtctgattatatttaaatgtattggataacatagctgtacatagtcctactgtgagagacagggtagcctagtatataaatgggaaccttagagcacagacccaccaacccttttgacctttgtgagcctcctgagtgtcaactgtcttaggagtggcaggcacagagcaccgacattcacacaccttgtctttccccatgtcccagtatatgaatgggggcaccctggaacagctgctcagctccccagaacccctctcctggccagtcaggctccacctagccctggacattgcacaaggcctacggtacctacacgccaaaggtgtgtttcaccgagacctcacatccaaggtaggctggccaagacgggtggaacgattaaagagggtttgtgactgttaagttgtaattggcctgtggatattgacatgtaggtagtagatacgttaggatg^TCGGGGTGCCAAGGTGTTGGAAACTATTAAAGAATGGGGACAGCAAGAGGGCTGGGGAATTGAGTACTGAGTGAGGTGGTGATAATGAGGTGCATTGGAGAACTGGGAGGGAAGGT
This mutation is a 899 bp deletion beginning at Chromosome 4 position 43,443,924 bp and ending after 43,444,822 bp (GRCm38/mm10). In addition, there is a 5 bp deletion (CCAAC) 175 bp before the deletion and a single bp [C] insertion at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42934 | GCA CCC TAA CAT CCT CAG GT | Common | A | |||
| 42935 | CAT CTC CCT CCT TTC CCA AG | Wild type Reverse | A | |||
| 42936 | CCT CTT GCT GTC CCC ATT CT | Mutant Reverse | A | |||
| 42937 | Fluorophore-1 | TTG CTG GGC AGG AGG A | Quencher-1 | WT Probe | ||
| 42938 | Fluorophore-2 | CTC TTC TCG GGG TGC CA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42934 | 0.40 uM |
| 42935 | 0.40 uM |
| 42936 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.