For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:97456904-97457011 108bp GCATCACCAGGGAAACAGTC AAGCGAGTGGAGTTGGTTC
Mut= 100 bp
Wt= 108 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GGACTTAGGTGAGGGGGTAAATAGGCTCCCGAAGCTGTGGGACTGGCAGCTGCGCCTGCGCACTCCACCGTACCTGACTGGCTGTTGTGTCTCCTAACTGGCATCACCAGGGAAACAGTCCACTGACCAGTTTCATGGCAGCCTCgaagcaaacctctgcgggaccgttggtaggagcggtggtccagggaaccaactccactcgctttctagttttcaatagcaaaacagcagaactagtttgctctcatcaggtggaactgacacaagaatacccaaaagaaggatgggtggagcaagaccccaaggaaatccttaaatctgtctatgagtgcatagcgaaagcttgtgaaaaacttgctgaagtgaacattgatatttccaacattaaagctatcggcgtgagtaaccagcgggaaaccactgtggtctgggacaagttcacgggagaccctctgtacaatgccgtggtgtggcttgatctcagaacccagtctactgtggagactctcactaagaaaatcccaggaaatagcaactttgtcaagtctaagaccggccttcctcttagcacttacttcagtgctgtgaagctgcggtggatgctggacaacctaagacccattcaaaaggctgttgaggaaggcagagccatgtttggaaccatcgactcttggctcatctggtgtatgaccggaggagtcaatggaggcatccattgcaccgatgtaacaaatgcatgcagaacgatgctttttaacatccactctttggaatgggataaagatctctgtgacttttttgaaattccaatgagcatcctcccaaatgtatgcagttcttctgagatctatggcctgatgacatcaggggccttggaaggcgtgccaatatctggatgtttgggggatcagtctgctgctttagtgggacaaatgtgtttccatgaaggtcaagccaaaaacacatacggaacaggctgttttttactatgtaatacaggccagaaatgtgtgttttctgaacatggccttctgaccacattggcttacaaactaggcaaaaataagccagttttttatgccttagaaggttctgttgctatagctggtgctgttattcgctggctaagagacaatttcgaaattataacaacctcaggggaagttgaaaatcttgcaagagaggtaggcacttcctatggctgctactttgtcccagccttttcggggctgtatgcaccttactgggaacccagtgcaagagggataatctgtggtctcactcagttcaccaacaaatgccatattgcctttgctgcgttagaagctgtttgtttccaaacccgagagattttggatgccatgaatcgcgactgtggaattccactcagtcatttgcaggtcgatggaggaatgaccaacaacaggattcttatgcagctacaggcagatattctgcacattccggtagttaagtctgtcatgcctgaaacgacggccctgggagctgccatggcagccggagctgcagaaggggtaaatgtttggagtcttgaacctgaagatttgtctacgatcttgatggaacgatatgaaccacaaatccaagccacagagagtgaaattcgtttttcaacatggaagagagcagtgatgaagtcaatgggttgggttacagcaaaggaccctgaaaatggcgataaccctgtcttctcttgtctgcccttgggtttttttatagtgagtagcatgacgttattaattgGAGCAAGATGTGTCTCAACTGCTGAAGAGTAATTTGAACCACGGACTTGCAATGTGTGAACTTTTTACAGAAAGAATTCCATCTTTTAGTGTGAAACCAATATTATAGGTTTATTTTTACCTATAGGCCACTTGCTTACAGGAACC
This mutation is a 1622 bp deletion beginning at Chromosome 5 position 97,455,345 bp and ending after 97,456,966 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42919 | GCA TCA CCA GGG AAA CAG TC | Common | A | |||
| 42920 | AAG CGA GTG GAG TTG GTT C | Wild type Reverse | A | |||
| 42921 | ACA TTG CAA GTC CGT GGT TC | Mutant Reverse | A | |||
| 42922 | Fluorophore-1 | ACC GTT GGT AGG AGC GGT | Quencher-1 | WT Probe | ||
| 42923 | Fluorophore-2 | AGC CTC GAG CAA GAT GTG TC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42919 | 0.40 uM |
| 42920 | 0.40 uM |
| 42921 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.