For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:56925264-56925360 97bp ACCAGGGCCTACTCTCCAAC TCCAGGCTCTCCCATATTCC
Mut= 97 bp
Wt= 97 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TTTTTTTTTTTGGACACCCTGTTGAACATCCTGAATCTGGGCAAGGCATTTTCCTTCCAGTCTTGACCTAACAGATAGCTGAGCCATGGCACTGAAAGGCCGAGCCCTCTATGATTTCCACAGTGAGAACAAGGAGGAAATCAGTAtccagcaggacgaagagctggttatcttcagtgagacctcactggacggctggctgcagggacagaacagccgtggggagacagggctcttccctgcttcttacgtcgagattgtccgtcctggcatcagcaccaaccatgtggactattccaacagccctgcaggctccctgggcacccaggggagtttgtatagcagcccgagtatggccagtccagccaggagtggtgggggcagcggcttcctctcaaacccaggaagcttcgaggatgatgatgatgatgattgggatgactgggatgatgggtgcacagtggtagaagagccactagctggcggcctaggtaccaatgggcaccctccactcaacctctcctacccgggtgcctaccccaaccagcatatggctttccgacccaaggcacccctggaaaggcaggacagcctggcgtctgccaagcggggcagtgtggtaggacggaacctcaatcgtttctcgtgcttcgtacgctctggagtggaggccttcatccttggtgatgtgcccatgatggccaagattgctgagacttactccattgagatgggcccacgtggccctcagtggaaggccaacccccacccatttgcctgctccatagaggaccccaccaaacagaccaagttcaaaggcattaaaagttacatctcttacaagcttacacccacccacgcaggctcgcctgtttaccggcgctacaaacactttgattggctgtacaaccgccttctacacaagttcacagtgatctcagtgccccacctgcctgagaagcaggccacaggccgcttcgaagaggacttcatcgagaagcgcaagcgaaggctcatcctctggatggaccacatgaccagccaccctgtgctctcccagtatgagggcttccagcacttcctcagctgcctggatgacaagcagtggaagatgggtaagcgccgggcagagaaggatgagatggtgggcgccagttttctgctcactttccagatccccacagagcaccaggatctgcaggatgtagaggaccgcgtggatacattcaaggctttcagtaagaagatggatgacagcgtcctacagcttagcaacgtggcggcggagctggtgcggaagcatgtggggggcttccgcaaggaattccagaagctaggaagtgccttccaggccattagccatgccttccagatggaccctccctttaggtctgatgctctcaacaatgccatttctcacactggccggacctatgaaaccgttggcgaaatgtttgcggaacagcccaagcacgacctcttccaaatgcttgacacactgtctctctaccagggcctactctccaacttccctgacattatccacctgcagaaAGGTAAGCCTGCATGAGTGTCCTGGTCCCTGGGAATATGGGAGAGCCTGGACTATGAACAGCTCATCACACTTTCCTGTCTCCATCTCCTTCGCTGCTCAACAAGTGTGTTAAGACAGTTCTCTGCAGAGTGCTGTTGT
This mutation is a 1408 bp deletion beginning at Chromosome 9 position 56,925,315 bp and ending after 56,926,722 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42671 | ACC AGG GCC TAC TCT CCA AC | Wild type Forward | A | |||
| 42672 | TCC AGG CTC TCC CAT ATT CC | Common | A | |||
| 42673 | CGA GCC CTC TAT GAT TTC CA | Mutant Forward | A | |||
| 42674 | Fluorophore-1 | CCC TGA CAT TAT CCA CCT GC | Quencher-1 | WT Probe | ||
| 42675 | Fluorophore-2 | AGG AGG AAA TCA GTA AGG TAA GCC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42671 | 0.40 uM |
| 42672 | 0.40 uM |
| 42673 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.