For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:105396607-105396694 88bp AAAAATGCTTCAAACTCAGAAGA TAAACGGAATCAATCCCAAAATG
Mut= 105 bp
Wt= 88 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AAACAAAAAAAAAAAAAAAACAAAAACAAAAACAAACAAAAAAAAAAAAACAAAAACAAAAAAAACCAAAAAACTCCATAGATTTTTTTTCCAAGGAAAATATCCTGTTATTTGATATAAAATTAGAAGAAAAAAAATGCTTCAAACTCAGAAGAAAAAAAATCattgagaattttaattattaccttgccattttacattttgggattgattccgtttattttaaaataccgtcccaaagcaagtcacatgctattttttctgagtattcagtgtcaaaacaaaacaaaacaaagttggttatgaggttttgatgttgaaggcagcactcttctctgtgggacagaccctagataacctgaaggaagggagacaccacctccgtgtgcggcctgccgacattcctgtggctgagagagcatccctgaactactggcggacatggaagtgtatcagcaagccctcggattttccaataaaaagccccgccttcacaggtaccgtcacgggcaggcccacaccctgaagtcaccagcttcgactctcctcgcccgaacagacgttaacctccatctgaactacttctgggtgctgcctctcttttcctcttctcttttgacccagtactgtcctctgcatggctgcttgcttactgggactcagcaccctgtgccattccgtcctgctgtatctaggcttcctttaggtgatatgatgtcatccAGTCTCTCCTGGCTCCATCATTATTTCAACTTACCTCAGACCACTACACAAAAATGCTCAGTGGTCTCTGGCTTCTGAGGCTCTTGCAGCATAGGGACATAAGTCCCTATGCTGGGACATCAGGAG
This mutation is a 559 bp deletion beginning at Chromosome 8 position 105,396,104 bp and ending after 105,396,662 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42632 | AAA AAT GCT TCA AAC TCA GAA GA | Common | A | |||
| 42633 | TAA ACG GAA TCA ATC CCA AAA TG | Wild type Reverse | A | |||
| 42634 | AGC CAG AGA CCA CTG AGC AT | Mutant Reverse | A | |||
| 42635 | Fluorophore-1 | ATT GAG AAT TTT AAT TAT TAC CTT GCC A | Quencher-1 | WT Probe | ||
| 42636 | Fluorophore-2 | ATC AGT CTC TCC TGG CTC CA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42632 | 0.40 uM |
| 42633 | 0.40 uM |
| 42634 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.