For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:80947685+80947809 125bp GCTGAGAACCCAGAAACTTGA CAGGTGGAGCATTTCTGAAG
Mut= 126 bp
Wt= 125 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GTGAATTGTTTTCCCAGAAAGATGTTAGAAGTGGCCAAGAAGCAGTGGCTTCTGTTAAGAAGTTAAAGTAACTGCTGGCTGGAGTTGATTCTCAGTCATCCCTAGCTTAGGGTTATAGTATCTGAGTGTAAGGTATATCTTAACACTTCCATGATTTTTTTTTTAAATttattttttatttttttggtttttcgagacagggcttctctgtatagctctggctgtcctggaactcactttgtagaccaggctggcctcgaactcaggaatctgtctgcctcccgagtgctgggattaaattaaaggcgtgcgccaccacgctcggcttccatgatcttaatgtgctgtagaatgcatgcacgtccaaaagctctactcttactgctacattttaggaatttgaggacccaagggatgcagatgatgctgtttatgaacttgatgggaaggaactttgcagtgaaaggtaagcatgattggtttataagtagttctcccagggaagtagagcagagtagacatttgcatatgtaagtgctctcatgtgtagtgtgtgaatgctttttttacctctttgtagggtgacgattgaacatgcccgggctcggtctcgaggtggaagaggtagaggacgatactccgaccgttttagcagtcgcagacctcgaaatgatagacggtatgtggtttgggtttggctgttacggttgggttagggtccgttagcattaaatggttctcagactagttaagtctagttagtccacatgctgagaacccagaaacttgatggaatcactatcttggcttaaacttgtcacatagcatttgacattgtgacataacatctgacactgaatgcTTATTTTTCTTTCTTCAGAAATGCTCCACCTGTAAGAACAGAAAATCGACTTATAGTTGAGAATTTATCCTCAAGAGTCAGCTGGCAGGTTTGTTGAAATACAGTTTTGAGATATTTTTTAATGTGGCATTTAAAAGTGTTAATGGGTAGTTAAT
This mutation is a 694 bp deletion beginning at Chromosome 12 position 80,947,084 bp and ending after 80,947,777 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41158 | GCT GAG AAC CCA GAA ACT TGA | Wild type Forward | A | |||
| 41159 | CAG GTG GAG CAT TTC TGA AG | Common | A | |||
| 41160 | CTG GCT GGA GTT GAT TCT CA | Mutant Forward | A | |||
| 41161 | Fluorophore-1 | TGG CTT AAA CTT GTC ACA TAG CA | Quencher-1 | WT Probe | ||
| 42553 | Fluorophore-2 | CAT CCC TAG CTT AGG GTT ATA GTA TCT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41158 | 0.40 uM |
| 41159 | 0.40 uM |
| 41160 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.