For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:41703683-41703822 140bp TAATTTCCATCAAGGAGAAGGAG TCAGTCACGAGGTTGGAGAC
Mut= 148 bp
Wt= 140 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AATTGAGATCTTAATTATATTGTTGCTTTAGTTCCCATTTACAATTCTCAGAGTCTAATTTCCATCAAGGAGAAGGAGCTTGAGAATCAGAATGCCTAATGAAGTCTGATTAGATTAGGCTACTGTTTCCTCTGctggttattgcaagtgcagtcagtattcctggggagggtgagtctccaacctcgtgactgattagagctgcaaaaagttgtttgttgagttcattaaagtatacatgttagtattacttaataagtttagaggtgttcttatgtttacattttttaaacaaagaaattaattttgctgttttgtgcatccattttttttttttttttagacctccttagctacgtgttttgctcaagagacatttgggaagcagtacaagcagacgataggactggatttctttttgagaaggattaccttaccaggtgagagactataaacctatgagactgtgtaggtctcgctcacagggcagccttactaggtaacagactatagaaccttacctgtgTGAGGTTATATAAGTCTCACAGGAATATTACCTGAAATTATCTATCATTAGCAACTAGTGTGAGCGTATACTGTCCACTGGGGTAAGAAAATGTTTATACAGTTCCCTATTCTATTGCTGTTAATAGCAACTCTGCAC
This mutation is a 392 bp deletion beginning at Chromosome 5 position 41,703,352 bp and ending after 41,703,743 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42311 | TAA TTT CCA TCA AGG AGA AGG AG | Common | A | |||
| 42312 | TCA GTC ACG AGG TTG GAG AC | Wild type Reverse | A | |||
| 42313 | ATA CGC TCA CAC TAG TTG CTA ATG A | Mutant Reverse | A | |||
| 42314 | Fluorophore-1 | TCA GTA TTC CTG GGG AGG GT | Quencher-1 | WT Probe | ||
| 42315 | Fluorophore-2 | CCT CTG TGA GGT TAT ATA AGT CTC ACA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42311 | 0.40 uM |
| 42312 | 0.40 uM |
| 42313 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.