For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr18:36450992-36451077 86bp GAGTAAATCAGCGCACCCTTC CCCAATTTGAAAATAAACCATTC
Mut= 88 bp
Wt= 86 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TCTGACTCCCAGTTGTTAGGATTATAGGTGGGAGACACCAGGTCTGGCTCTACAGCCAGGATTTTGAAATAACGTGGGTGTTTTGGATTCTAGTTATGCAATGCAGATGTAGTACGTTGTTTCCTGCTTTGGGTCTCTGGGTTTATCTCCTGAGTATtttatttatcccttttattactctctggctacttgataaatatggctttttttttttttaatgcacatttgtttttgtgttcatattggtcatgcggtctatggatagggtcaatgaatagggtacatttagaatttgcatagtgtgatcattctgttgacttttatctatgcttatcttggtaaatcttacagctttgtcaagttagcatgatctgttttaacaaatctaaatttgacttgaaagtttaatttcctaaatcaagcacttgtttttctcaggccttcacagagcttcaagccaaagttatcgatactcaacagaaggtgaagcttgcagacatacagattgaacagctgaacagaacgaaaaagcacgcacaccttacggacacggagatcatgacgctggtagatgagactaacatgtacgaaggtgtaggaagaatgtgagtaaatcagcgcacccttcacggggctctcttaggagaggcTTCAGGGGAATTAAATGGCAGAATGGTTTATTTTCAAATTGGGTTACTTAAAAAAGAAAACTTGGGTTAAAATAGAGAAATAACTTGCAAAAGCTATCTTTAAAAAAAAAAAAGGCATAAAACCCCAGGTGTGTGTTTTAAAATTTTATGTTTTTCACTCTCTCT
This mutation is a 493 bp deletion beginning at Chromosome 18 position 36,451,035 bp and ending after 36,451,527 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42302 | GAG TAA ATC AGC GCA CCC TTC | Wild type Forward | A | |||
| 42303 | CCC AAT TTG AAA ATA AAC CAT TC | Common | A | |||
| 42304 | TAC GTT GTT TCC TGC TTT GG | Mutant Forward | A | |||
| 42305 | Fluorophore-1 | ACG GGG CTC TCT TAG GAG AG | Quencher-1 | WT Probe | ||
| 42306 | Fluorophore-2 | CTG AGT ATT TCA GGG GAA TTA AAT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42302 | 0.40 uM |
| 42303 | 0.40 uM |
| 42304 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.