For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:109562326-109562457 132bp AGCCGGAGAGACAGGTAAGG CCTGCCACCAGTATCATGGA
Mut= 134 bp
Wt= 132 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TGGGAGGAGAGTAAGGATGACCAGAAGGATGCCGAGGAGGAGAGCGAGGACCAGGCTGGCCGAAGTAGCCGGAGAGACAGGTAAGGAGAGAGGGTAAAAAGTGGTGGTCAGAAAATATTCGCCCAGgttcacctcagctcctgtcggacacctaagagctttacggttttattgtgattccatgatactggtggcaggtaggagctggtaaggatttgcggggaaggctgctaagaagtggacgtaagtgcttgggttctagccctgtccaggccttcagcaccagggagatgcagtggagaggacatactgcttgttggcatggtcggaggtagagggaaatgttttctgccatggagacccctttcttcactctccctgtttcaggcattaccgatctgctcgggtagagactccgtcccaccccgggggtgtgagtgaagagttttgggaacgcagtaggcagagagagcgggatcggagggagcacggggtctatgcctcatctaaagaagaaaaggatcggaagaaggagagatcccgggatcgagactatgaccgcaagagagacagaggtaacgtgcctggcacccctcctggggtccgttagcatcgaaccagcaagcctttctcttcctgtcacaaggacttttacagtaatagtcattaattggacaacttggtttgtatagtgtgtgccccggtgGTTTTGACCCTTTGAGACTAGGATTAGGAAGAAGTTTAAGGAACGATACCTCTCTTGTAGGACAGCAACTTTGCTTGAGTGTGTGGATCTTGTTTTATTGTGAAAATTGGTGATAAAGGAAATGATGGGTGATCCATTGAAGAAGCCAGTATTTACACTA
This mutation is a 580 bp deletion beginning at Chromosome 8 position 109,561,818 bp and ending after 109,562,397 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42282 | AGC CGG AGA GAC AGG TAA GG | Common | A | |||
| 42283 | CCT GCC ACC AGT ATC ATG GA | Wild type Reverse | A | |||
| 42284 | GCA AAG TTG CTG TCC TAC AAG A | Mutant Reverse | A | |||
| 42285 | Fluorophore-1 | CCT CAG CTC CTG TCG GAC | Quencher-1 | WT Probe | ||
| 42286 | Fluorophore-2 | CCC AGG TTT TGA CCC TTT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42282 | 0.40 uM |
| 42283 | 0.40 uM |
| 42284 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.