For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chrX:106085385+106085536 152bp CATCTGTGGTGAGTGCCAGT GGTCATCCCTTCCACTTTCA
Mut= 165 bp
Wt= 152 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GGCCCCGTAAGATTTCTTTCATCCACACTGGTATGTCAACTGGTATTGTCGTTATGCAGGTCTTGTTTAGGTTCCATGGATGCAGCTATAAAAATTTTACCCACTCATATTCAATGTTCCCTGAGCTTTAGGTATAGGATTTATGTTACAGATGCATCAGTTGTGGATGAGGACCTCATGgtactcattttgaccagttgttgatttctgtaattgtccccatctgctgcagaaaagaaaacgtctttgatgagaagtgagagctacacctagcagggaaggccagcatgtgaactaagtgtctggagctaggcattggaatgtgaaatggctcaggaggacttggttcttgataattgatagtcttaattcctatgtcatacagctgagttaaacttctgaaatttctttcccaaaggtttcactagaagaaaagagtgcaaccattatttatgaccctaaacttcagactccaaagaccctccaagaagctatcgatgacatgggctttgatgctcttctccacaatgctaaccccctccctgtcttaaccaataccgtgttcctgactgttactgctccactgactctgccttgggaccatatccaaagtacattgctcaagaccaagggtgtgactggtgttaagatttcccctcagcaaagaagtgcagtagtcaccataattccatctgtggtgagtgccagtcagattgtggagctggtcccagacctcagtttagacatgggaactcaggagaaaaagtcaggagcttgtgaagagcacagcacgcctcaggcaggggaagtcatgctgaagatgaaagtggaagggatgacctgccattcatgtactagcaccattgaaggaaaagttggaaagctgcaaggtgttcagcgcattaaaggtaattttttttttgctcattttataaagctattctttgttttgatctttaaactttctgctttcttcccaagtatgagtttcagatccgtgggcctagaattgcttcctgcttcattgaagttagaagtgtagcatagtcccaggattaatgtcagtaaagttaatgattataatgaaaggttatgagagttgaacttcagtttagcaggaaaggcactgtgGTAGTGATTTGTGGAGTTTAGGCTTCCTGAACAGGCTGCCTTAGGCATATTTTATCTCTAATATATTTGTACTGGAGTGATGCAGAAACATGGAGACCATAGGAGCAGTGGTCATGTTGCTTGTTTCCAAAGTATGTCAATC
This mutation is a 951 bp deletion beginning at Chromosome X position 106,084,876 bp and ending after 106,085,826 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42276 | CAT CTG TGG TGA GTG CCA GT | Wild type Forward | A | |||
| 42277 | GGT CAT CCC TTC CAC TTT CA | Wild type Reverse | A | |||
| 42278 | TTG TCG TTA TGC AGG TCT TG | Mutant Forward | A | |||
| 42279 | TCA GGA AGC CTA AAC TCC ACA | Mutant Reverse | A | |||
| 42280 | Fluorophore-1 | AGA TTG TGG AGC TGG TCC C | Quencher-1 | WT Probe | ||
| 42281 | Fluorophore-2 | TGA GGA CCT CAT GGT AGT GAT TT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42276 | 0.40 uM |
| 42277 | 0.40 uM |
| 42278 | 0.40 uM |
| 42279 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.