For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr16:20608666-20608782 117bp CCTTGGTGCTTGTTTTCTTGA GTCAGCTCCCCAAACCTGA
Mut= 110 bp
Wt= 117 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CACGGCACTGGAGAGGCAGGACAAGGGATCCTTGAAGCAAACTGACTAGCTAGACTCTGTTATATAAATGACAGAGGAAGACACCAGTGTCAACTCCTGACCTTCATATGCATGCACACATAACACACAGACGAAATATATGGGTTCACCCAGAGaatgccgtaggtgtggttacatcagggacgataatgggagaaacctgggaatgaggtagaatctctgggctttggtggtctgaaggcatggggtttagaagtaggcaagttctggactcagaaggaacgagaccatgttatcttcttccagacacagagattgactggaaggcctacatggcccaggtggagggtttcatcaatggcacatatgactacacacagctgcagggtgacaccggacctcttgtgtgagtgaggataggaagtctgaaggcattgtgaagggctgggtgggtaccaggctgatagtcctgccctaggctcatatttcctttcatcttccagctacccagctgggtttttgtacatctttacggggctattctatgctactgaccggggcactgatatccctatggcccagaacatctttgctgtactctaccttgtcaccttggtgcttgttttcttgatataccaccagacctccaaggtgagttgatgccacaggaccaactggccctggcctgaagTGGGTGGTGGGGGTGGCTCAGGTTTGGGGAGCTGACGTTGGTGCCCACCCTTTAGGTACCTCCCTTCGTCTTTTTCTTCATGTGTTGTGCCTCTTACCGTGTCCATTCCATCTTTGTACTGCGGCTCTTCAATGACCCAGTAGCTATGGCCTTGC
This mutation is a 536 bp deletion beginning at Chromosome 16 position 20,608,702 bp and ending after 20,609,237 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42125 | CCT TGG TGC TTG TTT TCT TGA | Wild type Forward | A | |||
| 42126 | GTC AGC TCC CCA AAC CTG A | Common | A | |||
| 42127 | CAC CAG TGT CAA CTC CTG ACC | Mutant Forward | A | |||
| 42128 | Fluorophore-1 | ATA CCA CCA GAC CTC CAA GGT | Quencher-1 | WT Probe | ||
| 42129 | Fluorophore-2 | CAC CCA GAG TGG GTG GTG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42125 | 0.40 uM |
| 42126 | 0.40 uM |
| 42127 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.