For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:115280591-115280698 108bp CCTTAAACCTTGAAAACTGGTTC TGGCTACACATATCTCACTATGAAG
Mut= 121 bp
Wt= 108 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TCTTGATTTCTTAACTTTTTCATACGTTGTTACCTTGTAATTTGCCCTTCACTTTTGTCTGTTAAAATAACCTGCTTATGATTTAACTGGATAATCACAGTTTTCCTTAAACCTTGAAAACTGGTTCTTTTATCATCTGTTCATCACAGTAgtagcctcttcacagggacttgcttcacagttctctcttcatagtgagatatgtgtagccatatattgaatataaagaaaggtgtccttgtgttaactctttttataacatttcctcttctcttttgtccaggtttaactatagatcaacacatcatcttgcatctcatggattctatgagtttctaaattggtttgatgaaagagcatggtacccactgggaagaatagtgggtggcaccgtaagtatattccttacctttgcggtaactgtaaactgtggagtaaagcatttcctgctaagggacgagggtctcggaaggccgtcattagttcacagacacatcttccatggctaattagccagtgtttctcagctccgctcttggcagtttatttgtaggatatcttacactgccccccatttctgattgaggtcaggggctggattaagaatctgctgtcacaaagtacctcaagtccagagtgcttttcgctttgtttctgaacaattgagtttaaaagcttttgggggaaggaaataaaaattttgaaaatcaaattaattaaatgtttccagcctcaagcctctgaattaatgtagataattgaaccgtattgagtagggtagagtGTTCTGCCTCCAGAAGGATGACATGAAGGTTCTTAGGGTTCAGTGTGTAAGGAGAACTCCTAGAGAAGGGGGAAGATGTGGCAGGCAGCTCTCGGAGAAGTTTGTACACTTTCGTTTCTTCTTGAATTT
This mutation is a 633 bp deletion beginning at Chromosome 9 position 115,280,019 bp and ending after 115,280,651 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41319 | CCT TAA ACC TTG AAA ACT GGT TC | Common | A | |||
| 41320 | TGG CTA CAC ATA TCT CAC TAT GAA G | Wild type Reverse | A | |||
| 41321 | TTC CCC CTT CTC TAG GAG TTC | Mutant Reverse | A | |||
| 41322 | Fluorophore-1 | CAC AGG GAC TTG CTT CAC AGT | Quencher-1 | WT Probe | ||
| 41323 | Fluorophore-2 | CAT CAC AGT AGT TCT GCC TCC A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41319 | 0.40 uM |
| 41320 | 0.40 uM |
| 41321 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.