For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:88822194-88822288 95bp ACAGCCAAAGCAGCAAGACT TTGAGAAGAGGGGAGAACCA
Mut= 81 bp
Wt= 95 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AATGCAGAACTGAAGAGTCCTACATTTTTTCTCTGCAGGCAGTTTTTCCTGTGACTATTACTTGGGCTTTAAACAGTTATTTGCTACAGCCAAAGCAGCAAGACTTGTTTTTGTAATTCACCTGctgctggtagacctgctgctggtagactgaggaagttggttctcccctcttctcaaaaacacaaaaagggggtttttaaccccttatccttgtcctaagatgctggctgtggtccgtgctctgcagcttggtcagttgtcctggagttgcctcactaacagctgccttgctcttggcaggacgtcgagacttacttcttcgaggctctgctgaagtggagagagctgaaccttacggaacatttcggtaccgtctgcttctttctacttcatcttcccataatttgcacatcttatgttcccaacaactagtgaggcgatggagaaatagaacataatcctttttgctttctttcttttttccttttgttaatccagggaaattttacaaagaagtcattgacaaatgtcagtcttttaaccagttggtctatcatcaaaatgaaattgtccagagcttgaagactcacctgcaaattaggaacagtttggcctaccaacctcttttggagtaagtcacatctcagatgaaggctcaatagtgtttatctgagttctaaggaaaaccatgcttcatcactggccttaaattacggtctgtaatttagaagcaggatgagtatgccttccctgttagtttactgtatcagaaaaagatgtgtttctgtaaagcagcatcctggtgtacattgCACTTTCTCTGTGCTCCTAAGAGAGCTGTATGTTTCCTTGAAACCAGGGATGGGTGGCCCCAGTTCTGCTATCACTGTTTCTGACTTGAGACCAGGGATGGGTGG
This mutation is a 691 bp deletion beginning at Chromosome 10 position 88,821,559 bp and ending after 88,822,249 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41179 | ACA GCC AAA GCA GCA AGA CT | Common | A | |||
| 41180 | TTG AGA AGA GGG GAG AAC CA | Wild type Reverse | A | |||
| 41181 | TTC AAG GAA ACA TAC AGC TCT CTT AGG | Mutant Reverse | A | |||
| 41182 | Fluorophore-1 | CTG CTG CTG GTA GAC TGA GGA | Quencher-1 | WT Probe | ||
| 41183 | Fluorophore-2 | CAC CTG CAC TTT CTC TGT GC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41179 | 0.40 uM |
| 41180 | 0.40 uM |
| 41181 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.