For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:60428558-60428657 100bp GACCCAGGCTGAATTCTGTG CCTTAGAGGCTTGGGAAAGA
Mut= 122 bp
Wt= 100 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AGCCATCACAGTGCTCAAAGCCAGGGCTGCACTGTGACTCTCCTGGTCACTTAAATTGGTCTCTCATGGCTGAGTCCATATAAACTGAGACCCAGGCTGAATTCTGTGCATTCTGTTTTGCTTCTTAATTGTACCCTGTgtccacatgggtccagtagagaaatgagttctttcccaagcctctaaggttcaagactctaaccagcctctgtttctataggtcccacaacggatggcagtgaccgagggaaccccagaggacagtggcagtggctccccaggtgtgtggggctcctggggcccctggtctgcctgttctcgcagctgcagtggtggtgtgatggagcagacacggccctgcctgcccagctcctaccgtgctcgaggaggctcccggcccaatggccgtgcactgtccatcactggccacgttgtgtcagccgtacggacctcagtaccactgcatcgaagccaggaggaccaaagagccctggctggctccaatgctagccgccaaggccctgcagtggtgcgaggcagccgacatccacaggcccggggccgtgaaccctcagagagaaggtatgtgcacatcttggtccctgtgtctgtccctgcctggacaacagcagagccactaccttgattctgcagaATGGGAGGAATTCTTGCCACCATATTCATATGTGCCCATGGAGGCCAATGGAACCATAGGACAGCATCTGGGTCGATTCTTCAAGCCAAAACCTACTCTTGTTTTATTTAAAAACAAACAAACAAACAAACA
This mutation is a 516 bp deletion beginning at Chromosome 9 position 60,428,091 bp and ending after 60,428,606 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41173 | GAC CCA GGC TGA ATT CTG TG | Common | A | |||
| 41174 | CCT TAG AGG CTT GGG AAA GA | Wild type Reverse | A | |||
| 41175 | CCA GAT GCT GTC CTA TGG TT | Mutant Reverse | A | |||
| 41176 | Fluorophore-1 | TCC ACA TGG GTC CAG TAG AGA | Quencher-1 | WT Probe | ||
| 41177 | Fluorophore-2 | TGT ACC CTG TAT GGG AGG AAT T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41173 | 0.40 uM |
| 41174 | 0.40 uM |
| 41175 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.