For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:3675526-3675632 107bp GTTCCCAGTTTGTAGGTTCCA CCTGGATTCAGAGCCAGAAG
Mut= 97 bp
Wt= 107 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CAAGTGCTGGGATTAAAGGTGTGCCCCCCCCCCCACCACCCAGCTCAGATTTGGTTCCTTTTTAATTGCTAAAGAGTATTCCAGTTTATGGATACAGTACCACGATGCCTGTCCTCGTTACATCGTGTTGTTTCTGTCTTTGGGTGGTTCCCAGTTTGTAGGTTCCAAACCCTTCAttttctgacgctgactctgctctctttctaggaagagccaggctacagggcagctggcttctggctctgaatccagggctgcctactggacccgacagctttcccggaccaagggaaaaatgaaagaaggctttcaaactatacagccctgggcatggacgctgaagaaaattgggggtgtgctgggctttagaggaagaggcctggggtctgaggctggagtgtggtttcctgggtctgacagagaggggagtggcaattatcccctgggcctttgGGAAAAGGTCTGGTTCCTGCAGCCCTGGTCTGAAGGATGAAGACTAGTGCCTGAACCCTTCTGAATCAGAGAGAAGAGAACTGGAATCTGAGGGGGGAGGGCTGGTTTCTGGACCCCAGGGTCAGACCAGGAGTCAGGGCTCTGTTATAGATTTCTGGGTCTGAGGGAGGAGGGCTATGGCCAGGACTCTGGGTTGGAACTACACTGGTAAGGGACCTGAGGCCT
This mutation is a 277 bp deletion beginning at Chromosome 7 position 3,675,326 bp and ending after 3,675,602 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40951 | GTT CCC AGT TTG TAG GTT CCA | Common | A | |||
| 40952 | CCT GGA TTC AGA GCC AGA AG | Wild type Reverse | A | |||
| 40953 | GAT TCA GAA GGG TTC AGG CAC T | Mutant Reverse | A | |||
| 40954 | Fluorophore-1 | AGC CAG GCT ACA GGG CA | Quencher-1 | WT Probe | ||
| 40955 | Fluorophore-2 | TCA GGA AAA GGT CTG GTT CCT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40951 | 0.40 uM |
| 40952 | 0.40 uM |
| 40953 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.