For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:116088172+116088261 90bp ACGACACAGGTGACACAAGG GGAAGGAACATACCATATTAGTGC
Mut= 87 bp
Wt= 90 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case and insertion with carrots ^g^ (GCACAAATCTAGGTTT insertion):
CTGCCTTCTGCTTCCCAAGCGGTGCACACTTTTAATCCCAGTGGTGGAGAGGAACAGATCCCTTCAGCTTCTGGCCTGGTAGCCTAGCATATTTGCCAAGTCTCAATCCAGTAAGAACCTCTTACCAAAAAAGGTGGACAGCACCTAAGGAGCTATGCTGGACGACACAGGTGACACAAGGTATCACTTGTCAG^acaagggacactactgtagttaccctacagaaagcactaatatggtatgttccttcctgtttatatcccttgcttatctgtaaaatggggccaccagtaatgcatacctcaaaggtgtgaacactaaataaatttgcagatttaaactaaagcctatctcagtgagtactcagaaatgtttgctacaggaaagaaacttagagggcatttgacaaatttctggtgttttctttgctctttagagtgtgacttgctggcgagccaagtttatggaggcctttttttcccatgttctacgtggaaccattgatgtgtcttctgataaacgtctttgtgatcagcgcttctcacctctcctgcacagctcccgtcatgtccgacagctaaccatctgcaacatgctgcagggagcaactgagctagtggcagagcccaaccgtagggttctagagaccctggccagttctctgcataccctcaagttccgccacctgctgttctctgatgtggctgctcagcagtcacttcgacagctgctgcatcagctcatccaccatggggctgttagccaagtgtcgctgtactcctggcctgtgcccgagtcagcccttttcatccttattcttaccatgagtgctggcttttggcaaccaggcccaggtagcttgccttgccgcctctgtggtgaagcctcccgaggccgggccccatctagagatgaagggtccttattgctaggctctcgcaggcctcggcgtgatgcagcagagcgatgtgctgctgcactaatggccacccggcggaagagtgaagtcaagcagatgcccagggctgtacctcccactcgtgtaacacgccgcagcacacaagagagcctggcaataggtggaacagactctaagttgtacctcccagccacctcttatgaggcttctggcacaaaacagccatctgctccagctgcagcctctgcctcctcttccacatcatccaaacgggctccagctagctcagcctcacagcctaagcccttaaagcgtttcaaacgagctgcagggaagaaagggccccgcacccgtcaggggtctggtgcagagtctgaagacctgtatgactttgtttttattgtggctggtgagaaggaggatggtgaagagatggagattggggaagtagcttgtggagctctggatgggtcagatcccagctgtttggggctcccagcactagaggcatcccagcgattccgcagcatttccaccttggagctattcacagttcctctctccacggaggcagctctgacactgtgccatcttctgagttcctgggtatcactggagagccttacactttcctacaatggtgagcacctgaaggaacagggctgggcttgcatctctcaaaagcactgtgcctaatcaag^AGTGGAGAGTATGATTAAGGAGGTGGAAATGTGGTTATTTGTGTCTCGTGGAGGCAAAAGAGAAATACAAAAGACACACAGTGTTAGGAAAGGAAAATGAGGTCTGTAGTCTGGATTTACTATTGGAGgaaaggccaagGGGCTGAGAAGTCAGATAGATATAGAGGGCAATCCAGACACAGACAGGGCTCTGAATTTGTATCGCATCAGTCAAATTAAAGCAACTGACCAGGGATTTTTTTAAAG
This mutation is a 1426 bp deletion beginning at Chromosome 4 position 116,088,205 bp and ending after 116,089,630 bp (GRCm38/mm10). In addition, there is an 11bp deletion (CTTGGCCTTTC) 128 bp before the exon deletion, and a 16 bp insertion (AAACCTAGATTTGTGC) at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40844 | ACG ACA CAG GTG ACA CAA GG | Common | A | |||
| 40845 | GGA AGG AAC ATA CCA TAT TAG TGC | Wild type Reverse | A | |||
| 40846 | ATA ACC ACA TTT CCA CCT CCT | Mutant Reverse | A | |||
| 40847 | Fluorophore-1 | AAG GGA CAC TAC TGT AGT TAC CCT ACA | Quencher-1 | WT Probe | ||
| 40848 | Fluorophore-2 | CAC AAA TCT AGG TTT AGT GGA GAG TAT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40844 | 0.40 uM |
| 40845 | 0.40 uM |
| 40846 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.