For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:111333275+111333369 95bp GATATGGTGTGTATGTGGAATGG TGATGATGGCATGAAGATGG
Mut= 100 bp
Wt= 95 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TTTGACCCACACAATGGGTACAATACCCTGGAGTTCCCTGCTTATAGAGCCTGCCTCCAAGCCTGCAGAGCCCATTTCTACAGCCAGCTTCCAGGAGACTGTAATCATGGATCCTGAGAGGATATGGTGTGTATGTGGAATGGGCCATGCCACATCTGCATTTTTTGAAGccttggcaggaatgccatcccatccccatcttcatgccatcatcagctttacgttttctccagtgtaattttacatttcctctctacaaatataaaaatatttgtattgattggtgtgggatggaattaagatgtcgaaaccatttgtcaatttaaaaagtgtgagcagaatatttgggagcaagaagcaggtttgtacattgtaaagggccccgtccttttagggggttaagaggacagattttatatgcatatcagagatttcctgctaaccgctctgcctggtgacagcggtcagttccagagtcaggcccttgaggactgtgcctttgcagaatgatggctttattggtggctggtttgttcttcacaggactcctcctcgggaactggctatgctgctgtgcaacaaatccaatgcattttacaacctcgggaaatggaacgaggcttttcttgctgccaaggagtgtctccaatgggacccaacctatgtgaaggtatgggagggtggctgcttccctcttcctcctcttgatttgattgcttttttttttcctccttgtcaaagtggatattctagaaatgcttccccttgaacgcactTGCTCTTCTGAGGTCCATGGGCTGGGGGAGCCTTCCCTCCAGAGGAGCTAAGAGCAGGATAGTGAGTGTTGACACATGCTGCTGGGAGAGTGGGGCCTGACTGCCTGGTAGCTGGAGCTCAGTGAGAGGCGGGAGGAGCTCACTTAGACCTGAAGTAGTTAGACACAGATG
This mutation is a 606 bp deletion beginning at Chromosome 9 position 111,333,325 bp and ending after 111,333,930 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40821 | GAT ATG GTG TGT ATG TGG AAT GG | Common | A | |||
| 40822 | TGA TGA TGG CAT GAA GAT GG | Wild type Reverse | A | |||
| 40823 | TAG CTC CTC TGG AGG GAA GG | Mutant Reverse | A | |||
| 40824 | Fluorophore-1 | CTT GGC AGG AAT GCC ATC | Quencher-1 | WT Probe | ||
| 40825 | Fluorophore-2 | TTG AAG TGC TCT TCT GAG GTC C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40821 | 0.40 uM |
| 40822 | 0.40 uM |
| 40823 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.