For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr1:191582471+191582610 140bp CGTTCCCTATCCTCATCAACTC TGGACCAGAAGAAAAGACACAG
Mut= 140 bp
Wt= 140 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CATCAGATCTCATTACAGATGGTTGTGAGCCATGTGGTTGTTGGGACTTGGAACTTAGGACCTTTGGAAGAGCAGTCAGTGCTCTTAACCACTAAGCCATCTCTCCAGTTCCTTGAACAGTGCTTCTTTTTACTTGTTGAAAACTTGCTgtcctcctgtataagttagtatttgacatttctgtaagttagcttctgtcagtatttgacatatctgtaattagttcctcctgtgctttttcaataggactgaggtctggcaaactcggggagcagtgtgaggcagtcgtgcgctttcccaggcttttccagaagtacccgttccctatcctcatcaactcagcattcctaaagttagctgatgttttcagagttgggtaagtgtgctgaatgcctcagcagcccaaaggacaggctacttgtatctctgttttatactgtgtcttttcttctggtccattagaacttcttgccactcagttactctcggtgaatgcataatgctttgtaccatactttaatatgagatttaatgacacttttagaaaaaatgaaaaggttcagagcgaaattgtttcttcagggaacaagataaattaagtcagaacagccttattctgctactgtatatgtattttgtaaaattgtaggctttcttacagatgGTTTTAGAAATTCCTGATTTCATTTAGTGACTTGTAGGTACAGTCTTGGAGATGTGTATGCTCCTTACCCTTATCTCTTCTAAGCTGTGTGGAGGAAGATCGCCTGACTCACTGGCTGTCGCCT
This mutation is a 515 bp deletion beginning at Chromosome 1 position 191,582,302 bp and ending after 191,582,816 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40769 | CGT TCC CTA TCC TCA TCA ACT C | Wild type Forward | A | |||
| 40770 | TGG ACC AGA AGA AAA GAC ACA G | Wild type Reverse | A | |||
| 40771 | CCA GTT CCT TGA ACA GTG CTT | Mutant Forward | A | |||
| 40772 | CCT CCA CAC AGC TTA GAA GAG A | Mutant Reverse | A | |||
| 40773 | Fluorophore-1 | CAG AGT TGG GTA AGT GTG CTG A | Quencher-1 | WT Probe | ||
| 40774 | Fluorophore-2 | TGT TGA AAA CTT GCT GTT TTA GAA AT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40769 | 0.40 uM |
| 40770 | 0.40 uM |
| 40771 | 0.40 uM |
| 40772 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.