For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:90413194-90413273 80bp GGGGACTGAGAGGGAAATGA GGAGGGAGGAGCGTATGGTA
Mut= 82 bp
Wt= 80 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
AGAACAATATCATCCTCTCTGGTTTGGGGGGGAGGGCAGCAGTTCTAGAACATTCTTTCTCTCTCAAGGCAAAGGGAAAATGTTTACATCCTAAAagAGAGAACGGTTTATTCTAGCATTCAGGGCAATAGTGGTGGGAGAGTGGACcatcgggatgactgaagagatttattcgattagctgagttgctaattagagctactgtattctgattcttccccctcccaccccttgaaatcaggtggcgatgttacagccaaaaatatctggttggcagaaagtgtcctggatatcctgacggagcagaggtagagtctcccatgaagggtggggctgtgaggggtgtgagtatgggacatgggaaagaaaggctggtggctcagagcactctgaggccaggggaaggtgtggcaggcctgatggtggcagatggagaactaaggtcaaaagatggaggaatgggaaagaaggcgcttgctaaaatatctcagagcccagaaaatctggtctcatctgataagggtttatttttgacccagacctccttggaatgtttatgtttggggggactgagagggaaatgagctcagcagaggggccagccaacCACACGAGCCTGGCAGGTACCATACGCTCCTCCCTCCCAGCCTCAGGCCAGCACATGCTCTTTTTTGGAATGTCACAGGGCCAATGTAGGTGACTAGGGAGCAGAGAATCCTGCTATAAAGTGACATGGGGCCACATTTGAACTTC
This mutation is a 460 bp deletion beginning at Chromosome 3 position 90,413,231 bp and ending after 90,413,690 bp (GRCm38/mm10). In addition, there is a 2 bp deletion (AG) 50 bp before the exon deletion that will not alter the results of the exon deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40762 | GGG GAC TGA GAG GGA AAT GA | Wild type Forward | A | |||
| 40763 | GGA GGG AGG AGC GTA TGG TA | Common | A | |||
| 40764 | ACG GTT TAT TCT AGC ATT CAG G | Mutant Forward | A | |||
| 40765 | Fluorophore-1 | CAG AGG GGC CAG CCA | Quencher-1 | WT Probe | ||
| 40766 | Fluorophore-2 | AGT GGA CCA CAC GAG CCT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40762 | 0.40 uM |
| 40763 | 0.40 uM |
| 40764 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.