For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:44909874-44909992 119bp TGTTTTGTGGATGAGGAGACAG CCTTCCAGCCTATCTGTTGC
Mut= 137 bp
Wt= 119 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
TCTATTTCTGACGTATTGGTTGCAGGCGAGGTCTGGGTGCACAGATGTGACCCACAGTGTCTGCTAGTCTCTTTATTACCTATAGCAATGCAGGgtacacgaggGTGCTCACGATGCAGGGCCGAGCCAGCCTGCACATTTTGCCTGGCCCTGCCAGTTGTTTTGTGGATGAGGAGACAGAGTCTCTGGGGCAGCCAGGGCAGTTTCCAAGTGctttggggttgctctggctgcctatgtaatatcctggtcacgtggcaacagataggctggaaggtgcactggggccatgtagccctgactgccccacggtgtcccacagggacagcatggacagtgtgaagcagagtgccgccctatgcctactgcgactctacaaggcctcgcccgacttggtgcccatgggcgagtggacggcacgtgtagtgcacttgctcaatgatcagcacatggtgaggtgcccggccgccccaccctcaagtgcctgaagcccatgtcttgccttctgccctgacattccaacccagacctcctgtccccagtgtgtatgccctgcccagtttccaagaaaccttcttccttcctcgataactccttggctgcctgggactgtcctcatctctgatgcagtaccttaacaagatttgcctatttctgagcctagagagcccatagcaaggccagtggactgactgccttgcaaagactgaccccaccctagactcccattagcccaccctgctcctgactcctgagctgacttaccctgatgccagggctttcccagtgacacccagcatgaagtccctcacgcctgagctccttgcagggagtggtcacagctgctgtcagcctcatcacctgtctctgcaagaagaatccggatgacttcaagacctgtatctccctggctgtgtctcgcttaagccgggtgagtgtgctgtcacactggccgtgggagggtctggctcccctgtgtctgtgatatctgtctctcctcccttccctaaaaggcaagccagcctgtgcttagaagccaggactctgcattggcttcctcgggctgtgtgcccccaggcaaatggcttcacttctctttgcttcttttcctgtgtggttcaggggctggtgtcagtgcggtctgcagCATGGTTGCTGTGGTAAGGTGCTGACAGCTCCCCTGCCTGCTCTTCTTCCTCCTGTTTGTCTACACATCCCTCCTTTGCCTCCCACCACCTCCACCCTTGTCCCCAGAGCGCCGCCCCGAGCCTTCTGTGTGCCTGGCTCTCTATGTCT
This mutation is a 934 bp deletion beginning at Chromosome 7 position 44909004 bp and ending after 44909937 bp (GRCm38/mm10). In addition, there is a 10 bp deletion ( GTACACGAGG) 109 bp before the 934 bp del that will not alter the results of the exon deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37545 | CCT TCC AGC CTA TCT GTT GC | Wild type Reverse | A | |||
| 39982 | TGT TTT GTG GAT GAG GAG ACA G | Common | A | |||
| 39984 | Fluorophore-1 | CTG GCT GCC TAT GTA ATA TCC TG | Quencher-1 | |||
| 39985 | Fluorophore-2 | AGT GCA TGG TTG CTG TGG T | Quencher-2 | |||
| 40758 | GAG GCA AAG GAG GGA TGT GT | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37545 | 0.40 uM |
| 39982 | 0.40 uM |
| 40758 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.