For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 114 bp
Wild Type = 108 bp
>chr8:110841833-110841940 108bp CAATTGAGAAGCAGAAATTGGT CGTGATACACCAGAGTGTTCG
Sequence
Sequence (deletion in uppercase)
tttcttagtttatctcatcttcaatagatgattaatgatcttatttaaaagaataaatatttaggtttctgtcttttcatgaaatctgctactttatctcctttaacaacaggtgcaattgagaagcagaaattggtatatatcttgaacagagacgctgcagccCGACTTACCATTTCCTCTCCCCTGGAGGCCCACAAAGCGAACACTCTGGTGTATCACGTGGTTGGCGTAGACGTGGGATTTGAGAATCCTATGTTTGCTTGTCTGGAAATGGATTATGAGGTACCAAGGTGTCTCCCTCCCTCCTCCTCCTCCTTGGCTGTTTTCGTCATGTCCGATTTTTTCCTAAAACAAGTTTAATTGTGTCTGTAGATCTTAAAGTCATTCTTGCTAATGGATCTTTTTCAAGATATGAATGCTTTACTGAGAGTCTTTGCTGCACTTGACTGTGAAGTATCATCTGACTTGAATGACTGGACTGGGTCTGACCTGAGATATTTATTGAGAGGAGCTGCATGAGAAAAGCAGAGTTGTGTGTGGGGTTGGGGTGCTGGTTTGTTTAAGGGGAGCAGTAAAGGCTGAGCACACCGCTCCTGGCTTGGACGGAAGGCAGTGTTCTCTAGCAGTGCCCTGCCTGGGTCCAGAGCAGAGATTTGATCCtcgtggttctttctacctttgtagcttaaactttgtcaaactatttgcaatctgtgaacctttgcttcactgtatgtaaagtcctgatatcctttccaagtctaaaacttgatgattcgtttctgtggcactgtct
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40581 | CAA TTG AGA AGC AGA AAT TGG T | Common | A | |||
| 40582 | CGT GAT ACA CCA GAG TGT TCG | Wild type Reverse | A | |||
| 40583 | CAA AGG TTC ACA GAT TGC AAA TAG | Mutant Reverse | A | |||
| 40584 | Fluorophore-1 | CGC TGC AGC CCG ACT TAC CAT | Quencher-1 | WT Probe | ||
| 40585 | Fluorophore-2 | CGC TGC AGC CTC GTG GTT C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40581 | 0.40 uM |
| 40582 | 0.40 uM |
| 40583 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.