For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr13:46717404-46717513 110bp AAGATCCAGAAGGATGAAAACA CACAACTGTTTCCAGCAAAATTAC
Mut= 95 bp
Wt= 110 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CTCCACCAGCTGCACTAACCATATTTCTAGCTCTTTGTCTTCCTTAAAGAATGTGACACAAAATAATTGTTGAAATGACTTACAGTGTGTCTTTTAATGTATTAAGATCCAGAAGGATGAAAACATGTACTACCTACCACtaaatctagatcttggtataatgacataccattcacaaactgaatcttagtaattttgctggaaacagttgtgatttgcttggcatgactttctgtaagtacttacaaagataagttttctaaagtagtcttaatgtatgttttctccaacagggcattcttagcagggttacagaatctgttaagaatattgtaccagggtggctacaaagatacttcaacaagagtgaaaatgcttgcagctgttcaccagatgcagatgaagttccaccctggccagaaaatagagaagatgagcatgcgatttatgcggatgagaacacaaacactgatgatgggagaatcacccctgaccctgcaggcagtaacacagaaggtaaatactgtggatatttggttacaaagcgtagatcttcctaatttaaatatctttatattacctgagtgTGATAGCATCTGACCAAGTAATATATAAATCCTGTATGGAACATTTGGAATGAAGTTCACACTGAGTATGTTTATTGAGTAGTTTTTAAAAATATTTGTGTGTATATGCACATGGGCTGGCATGCCACAGTGTGTTGTGTGGAGATAAAGATCAA
This mutation is a 447 bp deletion beginning at Chromosome 13 position 46,717,030 bp and ending after 46,717,476 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40541 | AAG ATC CAG AAG GAT GAA AAC A | Common | A | |||
| 40542 | CAC AAC TGT TTC CAG CAA AAT TAC | Wild type Reverse | A | |||
| 40543 | GAA CTT CAT TCC AAA TGT TCC A | Mutant Reverse | A | |||
| 40544 | Fluorophore-1 | TAG ATC TTG GTA TAA TGA CAT ACC ATT CA | Quencher-1 | WT Probe | ||
| 40545 | Fluorophore-2 | ACC TAC CAC TGA TAG CAT CTG ACC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40541 | 0.40 uM |
| 40542 | 0.40 uM |
| 40543 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.