For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:4472959+4473068 110bp CATCCAAGCCTCTCTTTGGA TCACGTCATCATCTTGGGTCT
Mut= 96 bp
Wt= 110 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GCCTCTATTTCTCGTGGAACCCCATGAAGTACTCATGCACCATGACAACCAGTTTTATGCTGCTTGGATGATTAAACACAGGGCTTTGTGCGTGCCAGGCAAGAACCTTCCTTCCAACTGAACCACATCCAAGCCTCTCTTTGGATTTTACAAAAGTCATTTGTGTTTCTGCAGTGTGCCTGAGTTCtcaggcatttcactgagaacatgctagagacccaagatgatgacgtgacttagcaaaagtctctcgtgagttaatcttcccttctgtgttcttcttccagcccaagcttttggccaaggagcttcttgacctcgtggcctctcatttcaacctgaaggagaaggagtactttggaatagcattcacagatgagacgtaagtgctgtccagagcccacagaccccaaacaaaagagcaggatgtcaaattaccctctctctgctgtgcacagcaaaatcaggctgcaggccacttgggtcccatgggggctacagggtcagtccaagttcaccatctgaatttcaaaagccggtgATCATGCCTGGAGTGGCCAAAGGATATAATTAGATAGATGCTAATATTATGAAATTATTAGGTAATGTTCTTTAACCAAGCAGATTTGTGTTCAGATGAATGTCTAAAATGTTTATTTTTTTTAAAGAGTAGATCTGTGTGGGTTTAGTCTTTATTAAGGTTAAATGAAAACTTCTGGAAAGT
This mutation is a 354 bp deletion beginning at Chromosome 2 position 4,473,021 bp and ending after 4,473,374 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40535 | CAT CCA AGC CTC TCT TTG GA | Common | A | |||
| 40536 | TCA CGT CAT CAT CTT GGG TCT | Wild type Reverse | A | |||
| 40537 | TCT AAT TAT ATC CTT TGG CCA CTC C | Mutant Reverse | A | |||
| 40538 | Fluorophore-1 | CAG GCA TTT CAC TGA GAA CAT G | Quencher-1 | WT Probe | ||
| 40540 | Fluorophore-2 | AGT GTG CCT GAG TTC ATC ATG C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40535 | 0.40 uM |
| 40536 | 0.40 uM |
| 40537 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.