For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:104238232-104238312 81bp GAAGAAGTTGTGTGTGTGAGAGC AAACAGTAACATGTGAAAGTCATCC
Mut= 87 bp
Wt= 81 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GAATTGGAGTTACACAGACAGTTGTGAGCTGCCACATGGGTGCTAGGAACTGAACACAGGTCCTCTGAAAGAGCACACAGTGCTCTTAAACCACTGAGCTATCTTTCTAGCCCCAAGGTCATACTTTTTATGCAAGAATATTAATAGTTCCCACTAAAAtaagtggcggatagattttaattttgataacattttaggacattaaatttgaaaatataaaaataaactatatttaatcaccattgaactattgatcagccaacatatttctatttatagaaaaatatgaaagtgtattcattttgtgttaatatcatatgttttcatttaaaaatttgttgcttaatactaaatgtaagcatgtctttccttgtaggtataaacgagtcttttcagttggaacccatgcagttactacctataatcccaataccttagaagtaacaaatcaggtaattttaatagaagttgttgagggtttatgtgaacctttaaaagtcaagattgcagcccatcttccctgctgaagtcagcagttcagaagagaaatgtcagcctgaagatgaatgtgtatatatgatgccttgtgttcagacctagaagtgaagaagttgtgtgtgtgagagcgagcgcgggcacatgctttctagactcTCGAGGGGATGACTTTCACATGTTACTGTTTTTAGCCATCTCTATAAAATTCGTCCCTTTCTAAAGTTGTTACTATTAATCAAGCATATTAGTTATGTCACAAGTGTTATTGTTCACAGACTTTCCAAAGAACTAGAATTACTTGTTTGTAAAGGCAA
This mutation is a 495 bp deletion beginning at Chromosome 9 position 104,238,263 bp and ending after 104,238,757 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40349 | GAA GAA GTT GTG TGT GTG AGA GC | Wild type Forward | A | |||
| 40350 | AAA CAG TAA CAT GTG AAA GTC ATC C | Common | A | |||
| 40351 | TTT CTA GCC CCA AGG TCA TAC | Mutant Forward | A | |||
| 40352 | Fluorophore-1 | CGG GCA CAT GCT TTC TAG AC | Quencher-1 | WT Probe | ||
| 40353 | Fluorophore-2 | ATA TTA ATA GTT CCC ACT AAA ATC GAG G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40349 | 0.40 uM |
| 40350 | 0.40 uM |
| 40351 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.