For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 125 bp
Wild Type = 169 bp
>chr8:32276899-32277067 169bp CTGACTGGTCTGTGCAATCG GGTAGCACTGCCCTGAAGAG
Sequence
Wt Sequence (deletion in lower case):
AGTAGTTACTAACTATAAATGAACTTCTGTTGCTGAGTAATAGGGTATGGTCGTATCTGCATTTAGGTTTTTCTTGCGACTTTGTTGTTGTTTATAAGAATATATGTATTCATGTTAGGGGACGAGCGAGGCCTATTAAAAGATAGCTCTATCTTTTCATTCCCTAAAGACCCTTTCCTCACTGTGACACCCAGCAATGTGCTCTGACATGGTCCTCATCATCTTGTGTGTTTGTGCTTTGGTGGTGGTGTTGCTGgagcctacagtgagggcaaggattgagccatggagcaccagctgcaggccagagagcacggcctctttttatattaaacagcatctttggggccagagcaaaagggctttctttctgtcttgcaggtaatctggaatacactaggaaacaagcagttttgttctttcaaaataaggtgagtagattgcagcctagactaaaatgtgttcggccgcccgcttggttgtaaacatttctttccttgcatcctagaaccaagactcagggcttctgcagaaatgaatacagtctgactggtctgtgcaatcggtcgtcctgtcctctggcaaatagtcagtatgctaccattaaagaagagaaaggtacgggagctacacgacaatttataaacgGATGTCCCCAGCCTCTGTAAATAACAATAATAAAGCTGTCTAACTTCTCTTCAGGGCAGTGCTACCTGTACATGAAGGTTATAGAGCGAGCAGCTTTTCCCAGGCGTCTCTGGGAACGGGTAAGATTCAGTGAGAAAACTCTAGTGACCATTGGGCAAAAGCAAAATTGCCATGTAGGCCATCTCTGCACTTGAAAGCCACCCTCATAGATACCG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39027 | CTG ACT GGT CTG TGC AAT CG | Wild type Forward | A | |||
| 39028 | GGT AGC ACT GCC CTG AAG AG | Common | A | |||
| 39030 | Fluorophore-1 | TCC TGT CCT CTG GCA AAT AGT C | Quencher-1 | WT Probe | ||
| 40126 | TGT GCT CTG ACA TGG TCC TC | Mutant Forward | A | |||
| 40127 | Fluorophore-2 | CTT TGG TGG TGG TGT TGC TG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39027 | 0.40 uM |
| 39028 | 0.40 uM |
| 40126 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.