For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:99321872-99322023 152bp CGTGCGGTCCTAATTCAGAG CTCTTCCTCCTCCCATCCTC
Mut= 153 bp
Wt= 152 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AATCATGAAGTAGATTCAAGTATTTAACTTCATGTTAAACATGCCCTTGGCTGATAACTTAGTTGATTTTTATCATTAGCATTTTCTAACATTAAAAAAAAAACTTTACCAAAATAAATAAATAAATAAATACCACCTTTACcttttaaaattattgtgataaataatagcctttttaaaaagtcaaacccctggtttccagatcatcacctccaccaccagcaacgccaacgctgtactgcagattgacaatgccaggctcacggctgatgacttcagactcaagtaagtcagtgagcgaaaagaatccatggggattcgtgcggtcctaattcagagttgttcttaatccctccatcaaattctagtcagtcttactccaacgttagaaagcgcttggatttaaagtaagcaagatgaacctacaggggagaaaagactgttccagccagaggatgggaggaggaagaggaagtgctctagagaggccagccttagcCGAGGCATTCAAGGGGTACCTGAATAAAGTCAAGCCAATAAGATCCATCAAGATCCCAGCGGGCAGCACTGATTGGGCGCTAAGTTACAAAAAAACAAAAAAACAAAAAAAACAAAAA
This mutation is a 357 bp deletion beginning at Chromosome 11 position 99,321,844 bp and ending after 99,322,200 bp (GRCm38/mm10). In addition, there is a 10 bp deletion (ATCCCTTAAA) 160 bp after the 357 bp deletion, that will not alter the results of the exon deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39959 | CGT GCG GTC CTA ATT CAG AG | Wild type Forward | A | |||
| 39960 | CTC TTC CTC CTC CCA TCC TC | Wild type Reverse | A | |||
| 39961 | TGC CCT TGG CTG ATA ACT TAG | Mutant Forward | A | |||
| 39962 | CTT GAT GGA TCT TAT TGG CTT G | Mutant Reverse | A | |||
| 39963 | Fluorophore-1 | ATC CCT CCA TCA AAT TCT AGT CAG | Quencher-1 | WT Probe | ||
| 39964 | Fluorophore-2 | CCA CCT TTA CCG AGG CAT T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39959 | 0.40 uM |
| 39960 | 0.40 uM |
| 39961 | 0.40 uM |
| 39962 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.