For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:83421489+83421642 154bp TCTGCTTCCCTAACTAAATCTACTCAC CAGGACATAGAAATAGCTTCTCG
Mut= 145 bp
Wt= 154 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GTAGCTGGCGGGTGTCAGCTAACTCTGTGCCCTAGCTACCCCGGTGCTGGTCGGACCGAAAGGGGCTTATGCCCCTACTCAGGCCGGGTTTTCTGCTTCCCTAACTAAATCTACTCACTATTTCTAAACACTACAAACTGAATTGTAAAACTCTGCTCCttaaggaatattttgaaatttgataacttttcttttttaactattttaggccaaccaagccttcgagaagctatttctatgtcctgtataaccaatggaagtggtataagcagaaaacagaatcataccagctctgtatcaatagcaagaaaagaaactctttcttcagctgctaaaaggtacctgatagtaatggggtggggacactggccctgaACAACTGTGCATGATGATCTAGGTACTCATGAGAAGACTTCCAAGTAGAGCTCTGTGGGAGTCAAGCACGCATGCCTTGAATTCCTTTTTTTGTTGTTGTTTTTTTGGTTTTTTGTTTTTGCGAGACAGGGTTTCTCTGTGCAGTCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGGCCTCAA
This mutation is a 216 bp deletion beginning at Chromosome 17 position 83,421,557 bp and ending after 83,421,772 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39883 | TCT GCT TCC CTA ACT AAA TCT ACT CAC | Common | A | |||
| 39884 | CAG GAC ATA GAA ATA GCT TCT CG | Wild type Reverse | A | |||
| 39885 | AGG CAT GCG TGC TTG ACT C | Mutant Reverse | A | |||
| 39886 | Fluorophore-1 | TTT AGG CCA ACC AAG CCT T | Quencher-1 | WT Probe | ||
| 39887 | Fluorophore-2 | TGC TCC ACA ACT GTG CAT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39883 | 0.40 uM |
| 39884 | 0.40 uM |
| 39885 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.