For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:131326222-131326315 94bp GGAGGCAGATGATGAATGCT GGAATGACAAGCCTCAGCAG
Mut= 86 bp
Wt= 94 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
GGAGGACAGCTGACAGGGATGTAGGTCAGACAAGCGATGGTTTGAAGTTTGGGAGAGAAGCTTTAAGTATGAGAAAAACTGGCTGTCATGATGTCCCTTAAGAGGGACTTAGATTGTAGGGGCCAGAGCTGAGCCCAGCCAACTGCTGTGCCTTCTCTATTATCctcctgggcctgcaggagcccctggggcacagtcactctctttacttgtgatggaatctgggtttcacatgcatagcaattgtaggagaggaaaagatgggaaaggagcagagagctttaacccagggctggtgtcacatgtatgatgggttccaaccctggcctttctcacaaagccctcataattgtaagaagctcactgagaagggaaattctaagcttgttttgtgtcttttcttaagaatcgcaaaggaggcagatgatgaatgctatattgatccatgcaaggacccccatgagagcatcatcctggccaacagcatccctgctgaggcttgtcattcctaccaggccaacaccattgctgttgcgagttgcggtcccctccagtgttgtaatgtatgtggtgtctatgcagatgttaactccctgccaccctgcctttgtagcataagggaaggactctgacatggcacctatggataaaaggaaatcttcatgatcagtatttcaatttcttactagaatattttcttactcaagccaatttctatagtgtttatgttgtatactatctaacattgtgtttatgtacttttgtataAATgtacaatagtgaaaacaatctctgcctctattatgtttcctagtTATATTTCTTATACCACTATATGTATTACCACCGAGGACCAACCTCAGTCATTTTGGAGTTCTGAAGAATGGGAGGATTGGATTGGCACAAAATCAGAGACTCAGGCACAAATGCAGGTGCAAGCTGACAGGTCACCATTGCTGTT
This mutation is a 648 bp deletion beginning at Chromosome 7 position 131,325,916 bp for 46 bp to 131,325,962 bp retaining 3 bp TTA and then an additional 602 bp deletion ending after 131326566 (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39592 | GGA GGC AGA TGA TGA ATG CT | Wild type Forward | A | |||
| 39593 | GGA ATG ACA AGC CTC AGC AG | Wild type Reverse | A | |||
| 39594 | CCA ACT GCT GTG CCT TCT CT | Mutant Forward | A | |||
| 39595 | CCA AAA TGA CTG AGG TTG GTC | Mutant Reverse | A | |||
| 39596 | Fluorophore-1 | TGA TCC ATG CAA GGA CCC | Quencher-1 | WT Probe | ||
| 39597 | Fluorophore-2 | TCT TAT ACC ACT ATA TGT ATT ACC ACC GAG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39592 | 0.40 uM |
| 39593 | 0.40 uM |
| 39594 | 0.40 uM |
| 39595 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.