For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:20890030-20890127 98bp TTATTTGGTCTGGGTGTGGA TGTCGAAACTCCCAACACTG
Mut= 89 bp
Wt= 98 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GTGTCTAGAATTCTCAGAACATTGCTATATTTCATGAGCAGTTTGATGTTTTAAAAGGAAGATTTATTTTTGTAACAGGTACTTTAAAAATGTGCAGGCATATTTTAAAAAATACGGGCTTATTTGGTCTGGGTGTGGAGCTCAGACAGCaacgggtttgatcccagcaccatggaaacagagtgaagaggagggagcagtgttgggagtttcgacacagttactcagagtgagtagttctttcaaggagttcctaatatgttgttctccccccccccccctcttctttgaaggtgacagaattataaaagtcaatggagaaagtgtcataggaaagacctattcccaagtaattgctctcattcagaacaggtaagagtcttgaatcctgattaatatgggctaaaaccatatagcacaggtagcttttatacagttctgtgctcctaggacaagggtaacacagaatttcctccaaaactgcaagttgtgtatggtattgccaaatgttagcccactgattgttgagtgggtttgcaagttgtaatattcattgtaatgtttacaatgcaaaatcctatgGGTTCTGAGAGCACTCATTATAGATTTAAAATATGAGTTTTCCACTTTGATTTCAAGTGATAGGTATATAATTTGTTTAAATATAGAAATAAATGCACACTTGGTTTTCTAAAACAAGTCTTACTGACATTCATATTT
This mutation is a 432 bp deletion beginning at Chromosome 2 position 20,889,665 bp and ending after 20,890,096 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39549 | TTA TTT GGT CTG GGT GTG GA | Common | A | |||
| 39550 | TGT CGA AAC TCC CAA CAC TG | Wild type Reverse | A | |||
| 39551 | ACT TGA AAT CAA AGT GGA AAA CTC | Mutant Reverse | A | |||
| 39552 | Fluorophore-1 | TGA TCC CAG CAC CAT GG | Quencher-1 | WT Probe | ||
| 39553 | Fluorophore-2 | ACA GCG GTT CTG AGA GCA CT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39549 | 0.40 uM |
| 39550 | 0.40 uM |
| 39551 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.