For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:87290576+87290663 88bp GCTATCCACTGGGTTCCAGA GTTGCCTCTCCCAGGTCTCA
Mut= 86 bp
Wt= 88 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
ATGTGAGAGAATTGAAAATGACGCAGGAAACCGTACATGCCACATTCACTCTTTGGTTTCTAGGTCGTCCTGAGCAACATTAAAGTCCCTTAAGAGGAGACAAATTGACTACACAATCTCACAAACTAGGAGACTGTGAAACGGTCGATGAAGCCCTCACAATACGGTTCTCCTCTTCCgtggtttgagtgggtgggtgctttttgttttccaatgggttcttgctctgtcacccggactgagtgagaactctcttccgtcctcagagacgatttaggtttatggagaatgcacctttatcgtctcagacttgagccattcgtgcgctgggcagggatggctcggggctcaggatatctacagcgcatgttcaaggagtcaggaatccttgtcctgtttttccagatgactttgtgaaattgctgctagcggaggccctcctggagcagtgtctgaaggataaccacgacaaaataaaaaactccatccctttgctggagaagactgatcacaggctgaatgaagccaaggaccacctgagcagcctcctcaacaatgggaaactgccggtgagccttcaggttgtctcactcagaggtcagggcagagcggggatctctaggcagcaggtggattcttgtgtatcccaagtagctccagtggatatggagaagaggcgggaaaggcagtcccaagataaaaatcagaatcctacaatctgagtgattcctgaagtcccagctagctcagctctgtggagatcagtgacgtgaagccgctgccctagcttctgctatccactgggttccagaactgcagcatctcattaaggcttcctaggtacTTTTTAGCCCCATGTCTGAGACCTGGGAGAGGCAACCACATAGCCAAATTGGTTTCACCTGCTGTGGTGTCTCAAGCTCTTGAGATGCCCAAAGAACTGGAGTGGGAATAAAATAATGACCAAGGAACTTGGGCCAGTGGAAGGACAGCTTCTAGGGGTTTCGCGATCAGAGT
This mutation is a 665 bp deletion beginning at Chromosome 17 position 87289963 bp and ending after 87290627 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39513 | GCT ATC CAC TGG GTT CCA GA | Wild type Forward | A | |||
| 39514 | GTT GCC TCT CCC AGG TCT CA | Common | A | |||
| 39515 | GAG ACT GTG AAA CGG TCG ATG | Mutant Forward | A | |||
| 39516 | Fluorophore-1 | TGC AGC ATC TCA TTA AGG CTT | Quencher-1 | WT Probe | ||
| 39517 | Fluorophore-2 | TCT TCC TTT TTA GCC CCA TGT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39513 | 0.40 uM |
| 39514 | 0.40 uM |
| 39515 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.